EMAIL THIS PAGE TO A FRIEND

RNPC3

RNA-binding region (RNP1, RRM) containing 3

Synonyms: RBM40 RNP SNRNP65
Gene ID:
Human(55599) Summary: Two types of spliceosomes catalyze splicing of pre-mRNAs. The major U2-type spliceosome is found in all eukaryotes and removes U2-type introns, which represent more than 99% of pre-mRNA introns. The minor U12-type spliceosome is found in some eukaryotes and removes U12-type introns, which are rare and have distinct splice consensus signals. The U12-type spliceosome consists of several small nuclear RNAs and associated proteins. This gene encodes a 65K protein that is a component of the U12-type spliceosome. This protein contains two RNA recognition motifs (RRMs), suggesting that it may contact one of the small nuclear RNAs of the minor spliceosome. [provided by RefSeq, Jul 2008]
Mouse(67225) RNA-binding region (RNP1, RRM) containing 3
Rat(691538) RNA-binding region (RNP1, RRM) containing 3
Zebrafish(565672) RNA-binding region (RNP1, RRM) containing 3
dog(490136) RNA-binding region (RNP1, RRM) containing 3
domestic cat(101092872) RNA-binding region (RNP1, RRM) containing 3
chicken(424458) RNA-binding region (RNP1, RRM) containing 3
cow(768060) RNA-binding region (RNP1, RRM) containing 3
sheep(101118319) RNA-binding region (RNP1, RRM) containing 3
naked mole-rat(101703023) RNA-binding region (RNP1, RRM) containing 3
domestic guinea pig(100723783) RNA-binding region (RNP1, RRM) containing 3
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2103790 Anti-RNPC3 antibody produced in rabbit affinity isolated antibody human, rat, horse, rabbit, bovine, mouse
western blot pricing
HPA052434 Anti-RNPC3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017619 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017619 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017619 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026043 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026043 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026043 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU089021 MISSION® esiRNA esiRNA targeting mouse Rnpc3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017619 Rosetta Predictions human pricing
NM_001100810 Rosetta Predictions rat pricing
XM_001078734 Rosetta Predictions rat pricing
NM_001038696 Rosetta Predictions mouse pricing
NM_026043 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017619 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139264 predicted 1166
2 SASI_Hs02_00350288 predicted 1226
3 SASI_Hs01_00139265 predicted 964
4 SASI_Hs02_00350289 predicted 823
5 SASI_Hs01_00139266 predicted 220
6 SASI_Hs02_00350290 predicted 1017
7 SASI_Hs01_00139267 predicted 859
8 SASI_Hs01_00139268 predicted 980
9 SASI_Hs02_00350291 predicted 1007
10 SASI_Hs02_00350292 predicted 1023
11 SASI_Hs01_00139269 predicted 742
12 SASI_Hs01_00139270 predicted 880
13 SASI_Hs01_00139271 predicted 616
14 SASI_Hs01_00139272 predicted 566
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100810 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210622 predicted 904
2 SASI_Rn02_00210623 predicted 537
3 SASI_Rn02_00210624 predicted 800
4 SASI_Rn02_00210625 predicted 1395
5 SASI_Rn02_00210626 predicted 1169
6 SASI_Rn02_00210627 predicted 1183
7 SASI_Rn02_00210628 predicted 947
8 SASI_Rn02_00210629 predicted 490
9 SASI_Rn02_00210630 predicted 472
10 SASI_Rn02_00210631 predicted 1501
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078734 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00361839 predicted 1037
2 SASI_Rn02_00361840 predicted 676
3 SASI_Rn02_00361841 predicted 939
4 SASI_Rn02_00361842 predicted 1535
5 SASI_Rn02_00361843 predicted 1305
6 SASI_Rn02_00361844 predicted 1316
7 SASI_Rn02_00361845 predicted 1085
8 SASI_Rn02_00361846 predicted 630
9 SASI_Rn02_00361847 predicted 613
10 SASI_Rn02_00361848 predicted 1637
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038696 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153210 predicted 326
2 SASI_Mm01_00153211 predicted 997
3 SASI_Mm01_00153212 predicted 1244
4 SASI_Mm01_00153213 predicted 817
5 SASI_Mm01_00153214 predicted 713
6 SASI_Mm01_00153215 predicted 858
7 SASI_Mm01_00153216 predicted 783
8 SASI_Mm01_00153217 predicted 1194
9 SASI_Mm01_00153218 predicted 1085
10 SASI_Mm02_00289673 predicted 945
11 SASI_Mm01_00153209 predicted 293
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026043 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080404 predicted 322
2 SASI_Mm01_00080405 predicted 998
3 SASI_Mm01_00080406 predicted 1236
4 SASI_Mm01_00080407 predicted 816
5 SASI_Mm01_00080408 predicted 708
6 SASI_Mm01_00080409 predicted 852
7 SASI_Mm01_00080410 predicted 789
8 SASI_Mm01_00080411 predicted 1186
9 SASI_Mm01_00080412 predicted 1093
10 SASI_Mm02_00329548 predicted 948
11 SASI_Mm01_00080403 predicted 293
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017619
RNPC3 MISSION shRNA Bacterial Glycerol Stock
RNA-binding region (RNP1, RRM) containing 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017619.2-1478s1c1
Sequence:CCGGGAAGGTCGTATGAAAGGACAACTCGAGTTGTCCTTTCATACGACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017619.2-345s1c1
Sequence:CCGGGACTCCATCAACTGAAACTTTCTCGAGAAAGTTTCAGTTGATGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017619.2-1031s1c1
Sequence:CCGGCCACAACCTGTAGGTAACAAACTCGAGTTTGTTACCTACAGGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017619.2-647s1c1
Sequence:CCGGCAGGTCCTTCATCTTATGAATCTCGAGATTCATAAGATGAAGGACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017619.2-1539s1c1
Sequence:CCGGCCTTAAAGGAAGCTAATGGATCTCGAGATCCATTAGCTTCCTTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017619.2-987s1c1
Sequence:CCGGGCAGTTTACATCCAGTGCTGTCTCGAGACAGCACTGGATGTAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017619.3-1467s21c1
Sequence:CCGGAGCGGATCATGTTTGATATACCTCGAGGTATATCAAACATGATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017619.3-832s21c1
Sequence:CCGGATCTAGTGAAGAATCAGAATACTCGAGTATTCTGATTCTTCACTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017619.3-974s21c1
Sequence:CCGGGATATGTTGAATACACCTTTGCTCGAGCAAAGGTGTATTCAACATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017619.3-873s21c1
Sequence:CCGGACCGACAGAGAATGAACAAATCTCGAGATTTGTTCATTCTCTGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017619.3-612s21c1
Sequence:CCGGGCACAATCCTAGCAAACATTGCTCGAGCAATGTTTGCTAGGATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017619
RNPC3 MISSION shRNA shRNA Plasmid DNA
RNA-binding region (RNP1, RRM) containing 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017619.2-1478s1c1
Sequence:CCGGGAAGGTCGTATGAAAGGACAACTCGAGTTGTCCTTTCATACGACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017619.2-345s1c1
Sequence:CCGGGACTCCATCAACTGAAACTTTCTCGAGAAAGTTTCAGTTGATGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017619.2-1031s1c1
Sequence:CCGGCCACAACCTGTAGGTAACAAACTCGAGTTTGTTACCTACAGGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017619.2-647s1c1
Sequence:CCGGCAGGTCCTTCATCTTATGAATCTCGAGATTCATAAGATGAAGGACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017619.2-1539s1c1
Sequence:CCGGCCTTAAAGGAAGCTAATGGATCTCGAGATCCATTAGCTTCCTTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017619.2-987s1c1
Sequence:CCGGGCAGTTTACATCCAGTGCTGTCTCGAGACAGCACTGGATGTAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017619.3-1467s21c1
Sequence:CCGGAGCGGATCATGTTTGATATACCTCGAGGTATATCAAACATGATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017619.3-832s21c1
Sequence:CCGGATCTAGTGAAGAATCAGAATACTCGAGTATTCTGATTCTTCACTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017619.3-974s21c1
Sequence:CCGGGATATGTTGAATACACCTTTGCTCGAGCAAAGGTGTATTCAACATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017619.3-873s21c1
Sequence:CCGGACCGACAGAGAATGAACAAATCTCGAGATTTGTTCATTCTCTGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017619.3-612s21c1
Sequence:CCGGGCACAATCCTAGCAAACATTGCTCGAGCAATGTTTGCTAGGATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017619
RNPC3 MISSION shRNA Lentiviral Transduction Particles
RNA-binding region (RNP1, RRM) containing 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017619.2-1478s1c1
Sequence:CCGGGAAGGTCGTATGAAAGGACAACTCGAGTTGTCCTTTCATACGACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017619.2-345s1c1
Sequence:CCGGGACTCCATCAACTGAAACTTTCTCGAGAAAGTTTCAGTTGATGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017619.2-1031s1c1
Sequence:CCGGCCACAACCTGTAGGTAACAAACTCGAGTTTGTTACCTACAGGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017619.2-647s1c1
Sequence:CCGGCAGGTCCTTCATCTTATGAATCTCGAGATTCATAAGATGAAGGACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017619.2-1539s1c1
Sequence:CCGGCCTTAAAGGAAGCTAATGGATCTCGAGATCCATTAGCTTCCTTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017619.2-987s1c1
Sequence:CCGGGCAGTTTACATCCAGTGCTGTCTCGAGACAGCACTGGATGTAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017619.3-1467s21c1
Sequence:CCGGAGCGGATCATGTTTGATATACCTCGAGGTATATCAAACATGATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017619.3-832s21c1
Sequence:CCGGATCTAGTGAAGAATCAGAATACTCGAGTATTCTGATTCTTCACTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017619.3-974s21c1
Sequence:CCGGGATATGTTGAATACACCTTTGCTCGAGCAAAGGTGTATTCAACATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017619.3-873s21c1
Sequence:CCGGACCGACAGAGAATGAACAAATCTCGAGATTTGTTCATTCTCTGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017619.3-612s21c1
Sequence:CCGGGCACAATCCTAGCAAACATTGCTCGAGCAATGTTTGCTAGGATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026043
RNPC3 MISSION shRNA Bacterial Glycerol Stock
RNA-binding region (RNP1, RRM) containing 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026043.2-1493s1c1
Sequence:CCGGGCCGCTAAAGCGTTGAAAGAACTCGAGTTCTTTCAACGCTTTAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026043.3-1448s1c1
Sequence:CCGGCATGTTTGATATTCGCTTAATCTCGAGATTAAGCGAATATCAAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026043.3-793s1c1
Sequence:CCGGCAGATGAGGATGAGGATTTATCTCGAGATAAATCCTCATCCTCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215951    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026043.3-1874s1c1
Sequence:CCGGCTAAGGAAGTGTAACTTAATACTCGAGTATTAAGTTACACTTCCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026043.3-1001s1c1
Sequence:CCGGGCTGTTACCTTCGGATGTATTCTCGAGAATACATCCGAAGGTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026043.3-1001s21c1
Sequence:CCGGGCTGTTACCTTCGGATGTATTCTCGAGAATACATCCGAAGGTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026043.3-1029s21c1
Sequence:CCGGCCACAATCTGTAGGTAATAAACTCGAGTTTATTACCTACAGATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026043.3-1797s21c1
Sequence:CCGGTGTAGTAGCTTATCACATATACTCGAGTATATGTGATAAGCTACTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026043.3-1522s21c1
Sequence:CCGGCAGCCGCTAAAGCGTTGAAAGCTCGAGCTTTCAACGCTTTAGCGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026043.3-1449s21c1
Sequence:CCGGATGTTTGATATTCGCTTAATGCTCGAGCATTAAGCGAATATCAAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026043
RNPC3 MISSION shRNA shRNA Plasmid DNA
RNA-binding region (RNP1, RRM) containing 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026043.2-1493s1c1
Sequence:CCGGGCCGCTAAAGCGTTGAAAGAACTCGAGTTCTTTCAACGCTTTAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026043.3-1448s1c1
Sequence:CCGGCATGTTTGATATTCGCTTAATCTCGAGATTAAGCGAATATCAAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026043.3-793s1c1
Sequence:CCGGCAGATGAGGATGAGGATTTATCTCGAGATAAATCCTCATCCTCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215951    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026043.3-1874s1c1
Sequence:CCGGCTAAGGAAGTGTAACTTAATACTCGAGTATTAAGTTACACTTCCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026043.3-1001s1c1
Sequence:CCGGGCTGTTACCTTCGGATGTATTCTCGAGAATACATCCGAAGGTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026043.3-1001s21c1
Sequence:CCGGGCTGTTACCTTCGGATGTATTCTCGAGAATACATCCGAAGGTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026043.3-1029s21c1
Sequence:CCGGCCACAATCTGTAGGTAATAAACTCGAGTTTATTACCTACAGATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026043.3-1797s21c1
Sequence:CCGGTGTAGTAGCTTATCACATATACTCGAGTATATGTGATAAGCTACTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026043.3-1522s21c1
Sequence:CCGGCAGCCGCTAAAGCGTTGAAAGCTCGAGCTTTCAACGCTTTAGCGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026043.3-1449s21c1
Sequence:CCGGATGTTTGATATTCGCTTAATGCTCGAGCATTAAGCGAATATCAAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026043
RNPC3 MISSION shRNA Lentiviral Transduction Particles
RNA-binding region (RNP1, RRM) containing 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026043.2-1493s1c1
Sequence:CCGGGCCGCTAAAGCGTTGAAAGAACTCGAGTTCTTTCAACGCTTTAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026043.3-1448s1c1
Sequence:CCGGCATGTTTGATATTCGCTTAATCTCGAGATTAAGCGAATATCAAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026043.3-793s1c1
Sequence:CCGGCAGATGAGGATGAGGATTTATCTCGAGATAAATCCTCATCCTCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215951    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026043.3-1874s1c1
Sequence:CCGGCTAAGGAAGTGTAACTTAATACTCGAGTATTAAGTTACACTTCCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026043.3-1001s1c1
Sequence:CCGGGCTGTTACCTTCGGATGTATTCTCGAGAATACATCCGAAGGTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026043.3-1001s21c1
Sequence:CCGGGCTGTTACCTTCGGATGTATTCTCGAGAATACATCCGAAGGTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026043.3-1029s21c1
Sequence:CCGGCCACAATCTGTAGGTAATAAACTCGAGTTTATTACCTACAGATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026043.3-1797s21c1
Sequence:CCGGTGTAGTAGCTTATCACATATACTCGAGTATATGTGATAAGCTACTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026043.3-1522s21c1
Sequence:CCGGCAGCCGCTAAAGCGTTGAAAGCTCGAGCTTTCAACGCTTTAGCGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026043.3-1449s21c1
Sequence:CCGGATGTTTGATATTCGCTTAATGCTCGAGCATTAAGCGAATATCAAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks