EMAIL THIS PAGE TO A FRIEND

ROBO3

roundabout, axon guidance receptor, homolog 3 (Drosophila)

Synonyms: HGPPS HGPS RBIG1 RIG1
UniProtKB ID: Q96MS0
Gene ID:
Human(64221) Summary: This gene is a member of the Roundabout (ROBO) gene family that controls neurite outgrowth, growth cone guidance, and axon fasciculation. ROBO proteins are a subfamily of the immunoglobulin transmembrane receptor superfamily. SLIT proteins 1-3, a family of secreted chemorepellants, are ligands for ROBO proteins and SLIT/ROBO interactions regulate myogenesis, leukocyte migration, kidney morphogenesis, angiogenesis, and vasculogenesis in addition to neurogenesis. This gene, ROBO3, has a putative extracellular domain with five immunoglobulin (Ig)-like loops and three fibronectin (Fn) type III motifs, a transmembrane segment, and a cytoplasmic tail with three conserved signaling motifs: CC0, CC2, and CC3 (CC for conserved cytoplasmic). Unlike other ROBO family members, ROBO3 lacks motif CC1. The ROBO3 gene regulates axonal navigation at the ventral midline of the neural tube. In mouse, loss of Robo3 results in a complete failure of commissural axons to cross the midline throughout the spinal cord and the hindbrain. Mutations ROBO3 result in horizontal gaze palsy with progressive scoliosis (HGPPS); an autosomal recessive disorder characterized by congenital absence of horizontal gaze, progressive scoliosis, and failure of the corticospinal and somatosensory axon tracts to cross the midline in the medulla. Alternative transcript variants have been described but have not been experimentally validated. [provided by RefSeq, Dec 2009]
Mouse(19649) roundabout homolog 3 (Drosophila)
Rat(315564) roundabout, axon guidance receptor, homolog 3 (Drosophila)
fruit fly(33314) CG5423 gene product from transcript CG5423-RB
Horse(100072287) roundabout, axon guidance receptor, homolog 3 (Drosophila)
domestic cat(101084731) roundabout, axon guidance receptor, homolog 3 (Drosophila)
dog(489307) roundabout, axon guidance receptor, homolog 3 (Drosophila)
chicken(100858578) roundabout, axon guidance receptor, homolog 3 (Drosophila)
Zebrafish(30770) roundabout homolog 3
domestic guinea pig(100721535) roundabout, axon guidance receptor, homolog 3 (Drosophila)
naked mole-rat(101723272) roundabout, axon guidance receptor, homolog 3 (Drosophila)
Domestic Rabbit(100342258) roundabout, axon guidance receptor, homolog 3 (Drosophila)
cow(100337359) roundabout, axon guidance receptor, homolog 3 (Drosophila)
sheep(101117204) roundabout, axon guidance receptor, homolog 3 (Drosophila)
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022370 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022370 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022370 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011248 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011248 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011248 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU194011 MISSION® esiRNA esiRNA targeting mouse Robo3 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022370 Rosetta Predictions human pricing
NM_001108135 Rosetta Predictions rat pricing
NM_011248 Rosetta Predictions mouse pricing
XM_001476840 Rosetta Predictions mouse pricing
XM_001478301 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022370 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099511 predicted 2057
2 SASI_Hs01_00099512 predicted 2331
3 SASI_Hs01_00099513 predicted 1675
4 SASI_Hs01_00099514 predicted 1789
5 SASI_Hs01_00099515 predicted 1095
6 SASI_Hs01_00099516 predicted 4321
7 SASI_Hs01_00099517 predicted 2047
8 SASI_Hs01_00099519 predicted 1195
9 SASI_Hs01_00099520 predicted 1897
10 SASI_Hs02_00355672 predicted 3240
11 SASI_Hs01_00099518 predicted 2365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108135 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235704 predicted 1865
2 SASI_Rn02_00235705 predicted 2025
3 SASI_Rn02_00235706 predicted 2035
4 SASI_Rn02_00235707 predicted 3521
5 SASI_Rn02_00235708 predicted 3711
6 SASI_Rn02_00235709 predicted 2161
7 SASI_Rn02_00235710 predicted 4206
8 SASI_Rn02_00235711 predicted 2915
9 SASI_Rn02_00235712 predicted 4301
10 SASI_Rn02_00235713 predicted 769
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011248 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115188 predicted 1846
2 SASI_Mm01_00115189 predicted 1646
3 SASI_Mm01_00115190 predicted 1751
4 SASI_Mm01_00115191 predicted 319
5 SASI_Mm01_00115192 predicted 2585
6 SASI_Mm01_00115193 predicted 2932
7 SASI_Mm01_00115194 predicted 3373
8 SASI_Mm01_00115195 predicted 2029
9 SASI_Mm01_00115196 predicted 3708
10 SASI_Mm01_00115197 predicted 2039
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001476840 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00391667 predicted 1928
2 SASI_Mm02_00391668 predicted 3936
3 SASI_Mm02_00391669 predicted 1723
4 SASI_Mm02_00391670 predicted 1838
5 SASI_Mm02_00391671 predicted 2659
6 SASI_Mm02_00391672 predicted 3012
7 SASI_Mm02_00391673 predicted 3462
8 SASI_Mm02_00391674 predicted 2115
9 SASI_Mm02_00391675 predicted 3794
10 SASI_Mm02_00391676 predicted 400
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001478301 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00401680 predicted 1922
2 SASI_Mm02_00401681 predicted 3938
3 SASI_Mm02_00401682 predicted 1727
4 SASI_Mm02_00401683 predicted 1835
5 SASI_Mm02_00401684 predicted 2658
6 SASI_Mm02_00401685 predicted 3007
7 SASI_Mm02_00401686 predicted 3458
8 SASI_Mm02_00401687 predicted 2108
9 SASI_Mm02_00401688 predicted 3796
10 SASI_Mm02_00401689 predicted 406
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022370
VALIDATED
ROBO3 MISSION shRNA Bacterial Glycerol Stock
roundabout, axon guidance receptor, homolog 3 (Drosophila)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022370.3-826s21c1
Sequence:CCGGGAAGCTGATGATGTCACATACCTCGAGGTATGTGACATCATCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022370.2-1890s21c1
Sequence:CCGGGATCACCAAGAACAGCATTACCTCGAGGTAATGCTGTTCTTGGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022370.2-675s21c1
Sequence:CCGGGGCAGTCCTCCGTGATGATTTCTCGAGAAATCATCACGGAGGACTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022370.2-805s21c1
Sequence:CCGGGCAAGACTCAAGGAAGAGGAACTCGAGTTCCTCTTCCTTGAGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022370.2-1401s21c1
Sequence:CCGGGTCTCCAAGAGGCCAACTTAACTCGAGTTAAGTTGGCCTCTTGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022370.2-2633s21c1
Sequence:CCGGAGAGCCGCTTTCACCTCAATCCTCGAGGATTGAGGTGAAAGCGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022370.2-4365s1c1
Sequence:CCGGGCATTGAGAATATCATGAGTGCTCGAGCACTCATGATATTCTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022370.2-3156s1c1
Sequence:CCGGCCCGGACGACAGATATTACAACTCGAGTTGTAATATCTGTCGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022370.2-805s1c1
Sequence:CCGGGCAAGACTCAAGGAAGAGGAACTCGAGTTCCTCTTCCTTGAGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022370.2-2053s1c1
Sequence:CCGGCCCAATACCATCTACCTGTTTCTCGAGAAACAGGTAGATGGTATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022370.2-2366s1c1
Sequence:CCGGGCCAGCAAAGTACTGTGCTAACTCGAGTTAGCACAGTACTTTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022370
VALIDATED
ROBO3 MISSION shRNA shRNA Plasmid DNA
roundabout, axon guidance receptor, homolog 3 (Drosophila)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022370.3-826s21c1
Sequence:CCGGGAAGCTGATGATGTCACATACCTCGAGGTATGTGACATCATCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022370.2-1890s21c1
Sequence:CCGGGATCACCAAGAACAGCATTACCTCGAGGTAATGCTGTTCTTGGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022370.2-675s21c1
Sequence:CCGGGGCAGTCCTCCGTGATGATTTCTCGAGAAATCATCACGGAGGACTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022370.2-805s21c1
Sequence:CCGGGCAAGACTCAAGGAAGAGGAACTCGAGTTCCTCTTCCTTGAGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022370.2-1401s21c1
Sequence:CCGGGTCTCCAAGAGGCCAACTTAACTCGAGTTAAGTTGGCCTCTTGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022370.2-2633s21c1
Sequence:CCGGAGAGCCGCTTTCACCTCAATCCTCGAGGATTGAGGTGAAAGCGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022370.2-4365s1c1
Sequence:CCGGGCATTGAGAATATCATGAGTGCTCGAGCACTCATGATATTCTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022370.2-3156s1c1
Sequence:CCGGCCCGGACGACAGATATTACAACTCGAGTTGTAATATCTGTCGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022370.2-805s1c1
Sequence:CCGGGCAAGACTCAAGGAAGAGGAACTCGAGTTCCTCTTCCTTGAGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022370.2-2053s1c1
Sequence:CCGGCCCAATACCATCTACCTGTTTCTCGAGAAACAGGTAGATGGTATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022370.2-2366s1c1
Sequence:CCGGGCCAGCAAAGTACTGTGCTAACTCGAGTTAGCACAGTACTTTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022370
VALIDATED
ROBO3 MISSION shRNA Lentiviral Transduction Particles
roundabout, axon guidance receptor, homolog 3 (Drosophila)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022370.3-826s21c1
Sequence:CCGGGAAGCTGATGATGTCACATACCTCGAGGTATGTGACATCATCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022370.2-1890s21c1
Sequence:CCGGGATCACCAAGAACAGCATTACCTCGAGGTAATGCTGTTCTTGGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022370.2-675s21c1
Sequence:CCGGGGCAGTCCTCCGTGATGATTTCTCGAGAAATCATCACGGAGGACTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022370.2-805s21c1
Sequence:CCGGGCAAGACTCAAGGAAGAGGAACTCGAGTTCCTCTTCCTTGAGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022370.2-1401s21c1
Sequence:CCGGGTCTCCAAGAGGCCAACTTAACTCGAGTTAAGTTGGCCTCTTGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022370.2-2633s21c1
Sequence:CCGGAGAGCCGCTTTCACCTCAATCCTCGAGGATTGAGGTGAAAGCGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022370.2-4365s1c1
Sequence:CCGGGCATTGAGAATATCATGAGTGCTCGAGCACTCATGATATTCTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022370.2-3156s1c1
Sequence:CCGGCCCGGACGACAGATATTACAACTCGAGTTGTAATATCTGTCGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022370.2-805s1c1
Sequence:CCGGGCAAGACTCAAGGAAGAGGAACTCGAGTTCCTCTTCCTTGAGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022370.2-2053s1c1
Sequence:CCGGCCCAATACCATCTACCTGTTTCTCGAGAAACAGGTAGATGGTATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022370.2-2366s1c1
Sequence:CCGGGCCAGCAAAGTACTGTGCTAACTCGAGTTAGCACAGTACTTTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011248
ROBO3 MISSION shRNA Bacterial Glycerol Stock
roundabout, axon guidance receptor, homolog 3 (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011248.1-3376s1c1
Sequence:CCGGGCCTGTACAAATGCCATCTTTCTCGAGAAAGATGGCATTTGTACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011248.1-4387s1c1
Sequence:CCGGCCCAAATGTTTCTTAACCCATCTCGAGATGGGTTAAGAAACATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011248.1-2590s1c1
Sequence:CCGGCCTGGGTAATGAAAGCCGATTCTCGAGAATCGGCTTTCATTACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011248.1-3125s1c1
Sequence:CCGGCCAGATGATAGATACTACAATCTCGAGATTGTAGTATCTATCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011248.1-851s1c1
Sequence:CCGGGCTGGCATGTATATGTGCGTACTCGAGTACGCACATATACATGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011248
ROBO3 MISSION shRNA shRNA Plasmid DNA
roundabout, axon guidance receptor, homolog 3 (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011248.1-3376s1c1
Sequence:CCGGGCCTGTACAAATGCCATCTTTCTCGAGAAAGATGGCATTTGTACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011248.1-4387s1c1
Sequence:CCGGCCCAAATGTTTCTTAACCCATCTCGAGATGGGTTAAGAAACATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011248.1-2590s1c1
Sequence:CCGGCCTGGGTAATGAAAGCCGATTCTCGAGAATCGGCTTTCATTACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011248.1-3125s1c1
Sequence:CCGGCCAGATGATAGATACTACAATCTCGAGATTGTAGTATCTATCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011248.1-851s1c1
Sequence:CCGGGCTGGCATGTATATGTGCGTACTCGAGTACGCACATATACATGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011248
ROBO3 MISSION shRNA Lentiviral Transduction Particles
roundabout, axon guidance receptor, homolog 3 (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011248.1-3376s1c1
Sequence:CCGGGCCTGTACAAATGCCATCTTTCTCGAGAAAGATGGCATTTGTACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011248.1-4387s1c1
Sequence:CCGGCCCAAATGTTTCTTAACCCATCTCGAGATGGGTTAAGAAACATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011248.1-2590s1c1
Sequence:CCGGCCTGGGTAATGAAAGCCGATTCTCGAGAATCGGCTTTCATTACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011248.1-3125s1c1
Sequence:CCGGCCAGATGATAGATACTACAATCTCGAGATTGTAGTATCTATCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011248.1-851s1c1
Sequence:CCGGGCTGGCATGTATATGTGCGTACTCGAGTACGCACATATACATGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks