EMAIL THIS PAGE TO A FRIEND

RORB

RAR-related orphan receptor B

Synonyms: NR1F2 ROR-BETA RZR-BETA RZRB bA133M9.1
UniProtKB ID: Q92753, Q8WX73
Gene ID:
Human(6096) Summary: The protein encoded by this gene is a member of the NR1 subfamily of nuclear hormone receptors. It is a DNA-binding protein that can bind as a monomer or as a homodimer to hormone response elements upstream of several genes to enhance the expression of those genes. The specific functions of this protein are not known, but it has been shown to interact with NM23-2, a nucleoside diphosphate kinase involved in organogenesis and differentiation. [provided by RefSeq, Jul 2008]
Mouse(225998) RAR-related orphan receptor beta
Rat(309288) RAR-related orphan receptor B
Zebrafish(567943) RAR-related orphan receptor B
chicken(395980) RAR-related orphan receptor B
Horse(100049831) RAR-related orphan receptor B
domestic cat(101091819) RAR-related orphan receptor B
dog(484164) RAR-related orphan receptor B
cow(528382) RAR-related orphan receptor B
sheep(100169935) RAR-related orphan receptor B
Goat(100860875) RAR-related orphan receptor B
domestic guinea pig(100729096) RAR-related orphan receptor B
naked mole-rat(101707549) RAR-related orphan receptor B
Domestic Rabbit(100345295) RAR-related orphan receptor B
156 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1412066 ANTI-RORB antibody produced in mouse clone 1D8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412067 ANTI-RORB antibody produced in mouse clone 1E5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412068 ANTI-RORB antibody produced in mouse clone 2D12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2701639 Anti-rorb antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
HPA008393 Anti-RORB antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2102042 Anti-RORB antibody produced in rabbit affinity isolated antibody guinea pig, mouse, rat, rabbit, horse, sheep, human
western blot pricing
SAB2106714 Anti-RORB antibody produced in rabbit affinity isolated antibody mouse, sheep, guinea pig, goat, rabbit, yeast, human, horse
ELISA, western blot pricing
WH0006096M1 Monoclonal Anti-RORB antibody produced in mouse clone 4B4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404325 Monoclonal Anti-RORB antibody produced in mouse clone 1D1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146095 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146095 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146095 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006914 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006914 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006914 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU101081 MISSION® esiRNA esiRNA human RORB (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006914 Rosetta Predictions human pricing
XM_001079696 Rosetta Predictions rat pricing
XM_219749 Rosetta Predictions rat pricing
NM_001043354 Rosetta Predictions mouse pricing
NM_146095 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006914 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091495 predicted 1298
2 SASI_Hs01_00091496 predicted 1575
3 SASI_Hs01_00091499 predicted 1172
4 SASI_Hs02_00342591 predicted 2045
5 SASI_Hs01_00091500 predicted 1254
6 SASI_Hs01_00091502 predicted 1207
7 SASI_Hs02_00342592 predicted 1483
8 SASI_Hs02_00342593 predicted 1305
9 SASI_Hs01_00091503 predicted 1837
10 SASI_Hs02_00342594 predicted 672
11 SASI_Hs01_00091497 predicted 1285
12 SASI_Hs01_00091498 predicted 2087
13 SASI_Hs01_00091501 predicted 1572
14 SASI_Hs01_00091504 predicted 1516
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079696 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00365134 predicted 1676
2 SASI_Rn02_00365135 predicted 1589
3 SASI_Rn02_00365136 predicted 1231
4 SASI_Rn02_00365137 predicted 1270
5 SASI_Rn02_00365138 predicted 1892
6 SASI_Rn02_00365139 predicted 1526
7 SASI_Rn02_00365140 predicted 1256
8 SASI_Rn02_00365141 predicted 1585
9 SASI_Rn02_00365142 predicted 1941
10 SASI_Rn02_00365143 predicted 1293
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_219749 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378679 predicted 1674
2 SASI_Rn02_00378680 predicted 1586
3 SASI_Rn02_00378681 predicted 1226
4 SASI_Rn02_00378682 predicted 1275
5 SASI_Rn02_00378683 predicted 1891
6 SASI_Rn02_00378684 predicted 1525
7 SASI_Rn02_00378685 predicted 1262
8 SASI_Rn02_00378686 predicted 1585
9 SASI_Rn02_00378687 predicted 1935
10 SASI_Rn02_00378688 predicted 1287
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001043354 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291195 predicted 1660
2 SASI_Mm02_00291196 predicted 1203
3 SASI_Mm02_00291197 predicted 1249
4 SASI_Mm02_00291198 predicted 1869
5 SASI_Mm02_00291199 predicted 1503
6 SASI_Mm02_00291200 predicted 1243
7 SASI_Mm02_00291201 predicted 1295
8 SASI_Mm02_00291202 predicted 1094
9 SASI_Mm02_00291203 predicted 1271
10 SASI_Mm02_00291204 predicted 1919
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146095 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199070 predicted 1123
2 SASI_Mm01_00199071 predicted 667
3 SASI_Mm01_00199072 predicted 711
4 SASI_Mm01_00199073 predicted 1333
5 SASI_Mm01_00199074 predicted 973
6 SASI_Mm01_00199075 predicted 702
7 SASI_Mm01_00199076 predicted 764
8 SASI_Mm01_00199078 predicted 563
9 SASI_Mm02_00341734 predicted 732
10 SASI_Mm01_00199079 predicted 1380
11 SASI_Mm01_00199077 predicted 1085
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146095
RORB MISSION shRNA Bacterial Glycerol Stock
RAR-related orphan receptor B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146095.1-1012s1c1
Sequence:CCGGGCTGTGTCAGAACGATCAGATCTCGAGATCTGATCGTTCTGACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146095.1-772s1c1
Sequence:CCGGCGGGATAACAATGTCTGAGATCTCGAGATCTCAGACATTGTTATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146095.1-614s1c1
Sequence:CCGGGAAGGTTATTACAGCATAGATCTCGAGATCTATGCTGTAATAACCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146095.1-1181s1c1
Sequence:CCGGGCATTTGACTTTGCGAAGAATCTCGAGATTCTTCGCAAAGTCAAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146095.1-1487s1c1
Sequence:CCGGCCATTGTACAAGGAGCTCTTTCTCGAGAAAGAGCTCCTTGTACAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146095
RORB MISSION shRNA shRNA Plasmid DNA
RAR-related orphan receptor B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146095.1-1012s1c1
Sequence:CCGGGCTGTGTCAGAACGATCAGATCTCGAGATCTGATCGTTCTGACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146095.1-772s1c1
Sequence:CCGGCGGGATAACAATGTCTGAGATCTCGAGATCTCAGACATTGTTATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146095.1-614s1c1
Sequence:CCGGGAAGGTTATTACAGCATAGATCTCGAGATCTATGCTGTAATAACCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146095.1-1181s1c1
Sequence:CCGGGCATTTGACTTTGCGAAGAATCTCGAGATTCTTCGCAAAGTCAAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146095.1-1487s1c1
Sequence:CCGGCCATTGTACAAGGAGCTCTTTCTCGAGAAAGAGCTCCTTGTACAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146095
RORB MISSION shRNA Lentiviral Transduction Particles
RAR-related orphan receptor B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146095.1-1012s1c1
Sequence:CCGGGCTGTGTCAGAACGATCAGATCTCGAGATCTGATCGTTCTGACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146095.1-772s1c1
Sequence:CCGGCGGGATAACAATGTCTGAGATCTCGAGATCTCAGACATTGTTATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146095.1-614s1c1
Sequence:CCGGGAAGGTTATTACAGCATAGATCTCGAGATCTATGCTGTAATAACCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146095.1-1181s1c1
Sequence:CCGGGCATTTGACTTTGCGAAGAATCTCGAGATTCTTCGCAAAGTCAAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146095.1-1487s1c1
Sequence:CCGGCCATTGTACAAGGAGCTCTTTCTCGAGAAAGAGCTCCTTGTACAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006914
RORB MISSION shRNA Bacterial Glycerol Stock
RAR-related orphan receptor B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006914.2-1518s1c1
Sequence:CCGGCCGTGCCTTCAACCCATTAAACTCGAGTTTAATGGGTTGAAGGCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006914.2-732s1c1
Sequence:CCGGCCCAAGGCAGAGAAACTGTTTCTCGAGAAACAGTTTCTCTGCCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006914.2-1813s1c1
Sequence:CCGGGCAAAGTTAATAGCCAAGATACTCGAGTATCTTGGCTATTAACTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006914.2-1924s1c1
Sequence:CCGGCCGTTATACAAGGAGCTCTTTCTCGAGAAAGAGCTCCTTGTATAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006914.2-1316s1c1
Sequence:CCGGCCCACACCTATGAAGAAATTACTCGAGTAATTTCTTCATAGGTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006914.3-2048s21c1
Sequence:CCGGCATGGAATGCATCACCATTAACTCGAGTTAATGGTGATGCATTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006914.3-2342s21c1
Sequence:CCGGGAGCGGTACTTTACATGATTACTCGAGTAATCATGTAAAGTACCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006914.3-1463s21c1
Sequence:CCGGGGAGTTTGCAAAGCGGATAACCTCGAGGTTATCCGCTTTGCAAACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006914.3-1088s21c1
Sequence:CCGGGCCCAAGTCTGAGGGTTATTACTCGAGTAATAACCCTCAGACTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006914
RORB MISSION shRNA shRNA Plasmid DNA
RAR-related orphan receptor B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006914.2-1518s1c1
Sequence:CCGGCCGTGCCTTCAACCCATTAAACTCGAGTTTAATGGGTTGAAGGCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006914.2-732s1c1
Sequence:CCGGCCCAAGGCAGAGAAACTGTTTCTCGAGAAACAGTTTCTCTGCCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006914.2-1813s1c1
Sequence:CCGGGCAAAGTTAATAGCCAAGATACTCGAGTATCTTGGCTATTAACTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006914.2-1924s1c1
Sequence:CCGGCCGTTATACAAGGAGCTCTTTCTCGAGAAAGAGCTCCTTGTATAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006914.2-1316s1c1
Sequence:CCGGCCCACACCTATGAAGAAATTACTCGAGTAATTTCTTCATAGGTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006914.3-2048s21c1
Sequence:CCGGCATGGAATGCATCACCATTAACTCGAGTTAATGGTGATGCATTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006914.3-2342s21c1
Sequence:CCGGGAGCGGTACTTTACATGATTACTCGAGTAATCATGTAAAGTACCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006914.3-1463s21c1
Sequence:CCGGGGAGTTTGCAAAGCGGATAACCTCGAGGTTATCCGCTTTGCAAACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006914.3-1088s21c1
Sequence:CCGGGCCCAAGTCTGAGGGTTATTACTCGAGTAATAACCCTCAGACTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006914
RORB MISSION shRNA Lentiviral Transduction Particles
RAR-related orphan receptor B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006914.2-1518s1c1
Sequence:CCGGCCGTGCCTTCAACCCATTAAACTCGAGTTTAATGGGTTGAAGGCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006914.2-732s1c1
Sequence:CCGGCCCAAGGCAGAGAAACTGTTTCTCGAGAAACAGTTTCTCTGCCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006914.2-1813s1c1
Sequence:CCGGGCAAAGTTAATAGCCAAGATACTCGAGTATCTTGGCTATTAACTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006914.2-1924s1c1
Sequence:CCGGCCGTTATACAAGGAGCTCTTTCTCGAGAAAGAGCTCCTTGTATAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006914.2-1316s1c1
Sequence:CCGGCCCACACCTATGAAGAAATTACTCGAGTAATTTCTTCATAGGTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006914.3-2048s21c1
Sequence:CCGGCATGGAATGCATCACCATTAACTCGAGTTAATGGTGATGCATTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006914.3-2342s21c1
Sequence:CCGGGAGCGGTACTTTACATGATTACTCGAGTAATCATGTAAAGTACCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006914.3-1463s21c1
Sequence:CCGGGGAGTTTGCAAAGCGGATAACCTCGAGGTTATCCGCTTTGCAAACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006914.3-1088s21c1
Sequence:CCGGGCCCAAGTCTGAGGGTTATTACTCGAGTAATAACCCTCAGACTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks