EMAIL THIS PAGE TO A FRIEND

RORC

RAR-related orphan receptor C

Synonyms: NR1F3 RORG RZR-GAMMA RZRG TOR
UniProtKB ID: P51449, Q5SZR9, Q8N5V7, Q8NCY8
Gene ID:
Human(6097) Summary: The protein encoded by this gene is a DNA-binding transcription factor and is a member of the NR1 subfamily of nuclear hormone receptors. The specific functions of this protein are not known; however, studies of a similar gene in mice have shown that this gene may be essential for lymphoid organogenesis and may play an important regulatory role in thymopoiesis. In addition, studies in mice suggest that the protein encoded by this gene may inhibit the expression of Fas ligand and IL2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(19885) RAR-related orphan receptor gamma
Rat(368158) RAR-related orphan receptor C
Domestic Rabbit(100353540) RAR-related orphan receptor C
naked mole-rat(101700193) RAR-related orphan receptor C
domestic guinea pig(100726893) RAR-related orphan receptor C
cow(527470) RAR-related orphan receptor C
sheep(101119104) RAR-related orphan receptor C
Goat(100860876) RAR-related orphan receptor C
chicken(777355) RAR-related orphan receptor C
dog(483205) RAR-related orphan receptor C
domestic cat(101082078) RAR-related orphan receptor C
Horse(100060134) RAR-related orphan receptor C
166 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005060 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005060 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005060 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011281 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011281 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011281 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001523 Rosetta Predictions human pricing
NM_005060 Rosetta Predictions human pricing
XM_001058675 Rosetta Predictions rat pricing
XM_347322 Rosetta Predictions rat pricing
NM_011281 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001523 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223773 predicted 1942
2 SASI_Hs01_00223774 predicted 2131
3 SASI_Hs01_00223775 predicted 2110
4 SASI_Hs01_00223777 predicted 662
5 SASI_Hs01_00223778 predicted 1987
6 SASI_Hs02_00303813 predicted 997
7 SASI_Hs01_00223779 predicted 1980
8 SASI_Hs01_00223780 predicted 1856
9 SASI_Hs01_00223781 predicted 1982
10 SASI_Hs01_00223782 predicted 1757
11 SASI_Hs01_00223776 predicted 1870
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005060 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138734 predicted 1970
2 SASI_Hs01_00138735 predicted 2162
3 SASI_Hs01_00138736 predicted 2142
4 SASI_Hs01_00138738 predicted 695
5 SASI_Hs01_00138739 predicted 2020
6 SASI_Hs02_00338877 predicted 1027
7 SASI_Hs01_00138740 predicted 2008
8 SASI_Hs01_00138741 predicted 1884
9 SASI_Hs01_00138742 predicted 2005
10 SASI_Hs01_00138743 predicted 1793
11 SASI_Hs01_00138737 predicted 1895
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058675 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00290466 predicted 1143
2 SASI_Rn02_00290467 predicted 1815
3 SASI_Rn02_00290468 predicted 356
4 SASI_Rn02_00290469 predicted 1773
5 SASI_Rn02_00290470 predicted 1061
6 SASI_Rn02_00290471 predicted 1103
7 SASI_Rn02_00290472 predicted 1133
8 SASI_Rn02_00290473 predicted 817
9 SASI_Rn02_00290474 predicted 607
10 SASI_Rn02_00290475 predicted 1074
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_347322 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00399646 predicted 360
2 SASI_Rn02_00399647 predicted 707
3 SASI_Rn02_00399648 predicted 406
4 SASI_Rn02_00399649 predicted 724
5 SASI_Rn02_00399650 predicted 960
6 SASI_Rn02_00399651 predicted 478
7 SASI_Rn02_00399652 predicted 1009
8 SASI_Rn02_00399653 predicted 822
9 SASI_Rn02_00399654 predicted 484
10 SASI_Rn02_00399655 predicted 946
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011281 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068644 predicted 1126
2 SASI_Mm01_00068647 predicted 1375
3 SASI_Mm01_00068648 predicted 356
4 SASI_Mm01_00068645 predicted 1557
5 SASI_Mm01_00068650 predicted 1214
6 SASI_Mm01_00068651 predicted 845
7 SASI_Mm01_00068652 predicted 609
8 SASI_Mm01_00068653 predicted 399
9 SASI_Mm02_00320323 predicted 1049
10 SASI_Mm02_00320324 predicted 509
11 SASI_Mm01_00068646 predicted 1138
12 SASI_Mm01_00068649 predicted 1202
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005060
RORC MISSION shRNA Bacterial Glycerol Stock
RAR-related orphan receptor C
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005060.2-618s1c1
Sequence:CCGGGCCCTCATATTCCAACAACTTCTCGAGAAGTTGTTGGAATATGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005060.2-135s1c1
Sequence:CCGGCACCTCACAAATTGAAGTGATCTCGAGATCACTTCAATTTGTGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005060.2-1308s1c1
Sequence:CCGGCGAGGATGAGATTGCCCTCTACTCGAGTAGAGGGCAATCTCATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005060.2-1430s1c1
Sequence:CCGGTCTGCAAGACTCATCGCCAAACTCGAGTTTGGCGATGAGTCTTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005060.2-1122s1c1
Sequence:CCGGGCTTCTCAAAGCAGGAGCAATCTCGAGATTGCTCCTGCTTTGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005060
RORC MISSION shRNA shRNA Plasmid DNA
RAR-related orphan receptor C
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005060.2-618s1c1
Sequence:CCGGGCCCTCATATTCCAACAACTTCTCGAGAAGTTGTTGGAATATGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005060.2-135s1c1
Sequence:CCGGCACCTCACAAATTGAAGTGATCTCGAGATCACTTCAATTTGTGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005060.2-1308s1c1
Sequence:CCGGCGAGGATGAGATTGCCCTCTACTCGAGTAGAGGGCAATCTCATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005060.2-1430s1c1
Sequence:CCGGTCTGCAAGACTCATCGCCAAACTCGAGTTTGGCGATGAGTCTTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005060.2-1122s1c1
Sequence:CCGGGCTTCTCAAAGCAGGAGCAATCTCGAGATTGCTCCTGCTTTGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005060
RORC MISSION shRNA Lentiviral Transduction Particles
RAR-related orphan receptor C
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005060.2-618s1c1
Sequence:CCGGGCCCTCATATTCCAACAACTTCTCGAGAAGTTGTTGGAATATGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005060.2-135s1c1
Sequence:CCGGCACCTCACAAATTGAAGTGATCTCGAGATCACTTCAATTTGTGAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005060.2-1308s1c1
Sequence:CCGGCGAGGATGAGATTGCCCTCTACTCGAGTAGAGGGCAATCTCATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005060.2-1430s1c1
Sequence:CCGGTCTGCAAGACTCATCGCCAAACTCGAGTTTGGCGATGAGTCTTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005060.2-1122s1c1
Sequence:CCGGGCTTCTCAAAGCAGGAGCAATCTCGAGATTGCTCCTGCTTTGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011281
RORC MISSION shRNA Bacterial Glycerol Stock
RAR-related orphan receptor C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011281.1-526s1c1
Sequence:CCGGCGGAGCAGACACACTTACATACTCGAGTATGTAAGTGTGTCTGCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011281.1-1133s1c1
Sequence:CCGGTGCCAGAATGACCAGATCATACTCGAGTATGATCTGGTCATTCTGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011281.1-701s1c1
Sequence:CCGGCACCTTGAGTATAGTCCAGAACTCGAGTTCTGGACTATACTCAAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011281.1-1597s1c1
Sequence:CCGGGCCACTCTATAAGGAACTCTTCTCGAGAAGAGTTCCTTATAGAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011281.1-1282s1c1
Sequence:CCGGCGAGCTCATCAGCTCCATATTCTCGAGAATATGGAGCTGATGAGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011281
RORC MISSION shRNA shRNA Plasmid DNA
RAR-related orphan receptor C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011281.1-526s1c1
Sequence:CCGGCGGAGCAGACACACTTACATACTCGAGTATGTAAGTGTGTCTGCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011281.1-1133s1c1
Sequence:CCGGTGCCAGAATGACCAGATCATACTCGAGTATGATCTGGTCATTCTGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011281.1-701s1c1
Sequence:CCGGCACCTTGAGTATAGTCCAGAACTCGAGTTCTGGACTATACTCAAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011281.1-1597s1c1
Sequence:CCGGGCCACTCTATAAGGAACTCTTCTCGAGAAGAGTTCCTTATAGAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011281.1-1282s1c1
Sequence:CCGGCGAGCTCATCAGCTCCATATTCTCGAGAATATGGAGCTGATGAGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011281
RORC MISSION shRNA Lentiviral Transduction Particles
RAR-related orphan receptor C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011281.1-526s1c1
Sequence:CCGGCGGAGCAGACACACTTACATACTCGAGTATGTAAGTGTGTCTGCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011281.1-1133s1c1
Sequence:CCGGTGCCAGAATGACCAGATCATACTCGAGTATGATCTGGTCATTCTGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011281.1-701s1c1
Sequence:CCGGCACCTTGAGTATAGTCCAGAACTCGAGTTCTGGACTATACTCAAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011281.1-1597s1c1
Sequence:CCGGGCCACTCTATAAGGAACTCTTCTCGAGAAGAGTTCCTTATAGAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011281.1-1282s1c1
Sequence:CCGGCGAGCTCATCAGCTCCATATTCTCGAGAATATGGAGCTGATGAGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks