EMAIL THIS PAGE TO A FRIEND

RP1

retinitis pigmentosa 1 (autosomal dominant)

Synonyms: DCDC4A ORP1
UniProtKB ID: P56715
Gene ID:
Human(6101) Summary: This gene encodes a member of the doublecortin family. The protein encoded by this gene contains two doublecortin domains, which bind microtubules and regulate microtubule polymerization. The encoded protein is a photoreceptor microtubule-associated protein and is required for correct stacking of outer segment disc. This protein and the RP1L1 protein, another retinal-specific protein, play essential and synergistic roles in affecting photosensitivity and outer segment morphogenesis of rod photoreceptors. Because of its response to in vivo retinal oxygen levels, this protein was initially named ORP1 (oxygen-regulated protein-1). This protein was subsequently designated RP1 (retinitis pigmentosa 1) when it was found that mutations in this gene cause autosomal dominant retinitis pigmentosa. Mutations in this gene also cause autosomal recessive retinitis pigmentosa. Transcript variants resulted from an alternative promoter and alternative splicings have been found, which overlap the current reference sequence and has several exons upstream and downstream of the current reference sequence. However, the biological validity and full-length nature of some variants cannot be determined at this time.[provided by RefSeq, Sep 2010]
Mouse(19888) retinitis pigmentosa 1 (human)
Rat(681377) retinitis pigmentosa 1 (human)
Thale Cress(840916) 60S ribosomal protein L3-1
Thale Cress(827869) pyruvate, phosphate dikinase regulatory protein 1
dog(403565) retinitis pigmentosa 1 (autosomal dominant)
Horse(100053179) retinitis pigmentosa 1 (autosomal dominant)
cow(280916) retinitis pigmentosa 1 (autosomal dominant)
sheep(101114620) retinitis pigmentosa 1 (autosomal dominant)
naked mole-rat(101708003) retinitis pigmentosa 1 (autosomal dominant)
Domestic Rabbit(100355685) retinitis pigmentosa 1 (autosomal dominant)
domestic guinea pig(100715117) retinitis pigmentosa 1 (autosomal dominant)
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006269 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006269 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006269 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011283 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011283 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011283 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU048141 MISSION® esiRNA esiRNA human RP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006269 Rosetta Predictions human pricing
XM_001061481 Rosetta Predictions rat pricing
NM_011283 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006269 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095834 predicted 1775
2 SASI_Hs02_00341229 predicted 3681
3 SASI_Hs02_00341230 predicted 1507
4 SASI_Hs01_00095836 predicted 3767
5 SASI_Hs01_00095837 predicted 1797
6 SASI_Hs01_00095838 predicted 2800
7 SASI_Hs01_00095840 predicted 4109
8 SASI_Hs02_00341231 predicted 2680
9 SASI_Hs02_00341232 predicted 4290
10 SASI_Hs02_00341233 predicted 1760
11 SASI_Hs01_00095835 predicted 6360
12 SASI_Hs01_00095839 predicted 346
13 SASI_Hs01_00095841 predicted 3702
14 SASI_Hs01_00095842 predicted 1416
15 SASI_Hs01_00095843 predicted 6109
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061481 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00300254 predicted 673
2 SASI_Rn02_00300255 predicted 235
3 SASI_Rn02_00300256 predicted 304
4 SASI_Rn02_00300257 predicted 602
5 SASI_Rn02_00300258 predicted 274
6 SASI_Rn02_00300259 predicted 290
7 SASI_Rn02_00300260 predicted 597
8 SASI_Rn02_00300261 predicted 738
9 SASI_Rn02_00300262 predicted 416
10 SASI_Rn02_00300263 predicted 329
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011283 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173785 predicted 6104
2 SASI_Mm01_00173787 predicted 1266
3 SASI_Mm01_00173788 predicted 5441
4 SASI_Mm01_00173789 predicted 2983
5 SASI_Mm01_00173790 predicted 4343
6 SASI_Mm01_00173791 predicted 4779
7 SASI_Mm01_00173792 predicted 6515
8 SASI_Mm01_00173793 predicted 4061
9 SASI_Mm01_00173794 predicted 5888
10 SASI_Mm02_00320328 predicted 5763
11 SASI_Mm01_00173786 predicted 3759
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006269
RP1 MISSION shRNA Bacterial Glycerol Stock
retinitis pigmentosa 1 (autosomal dominant)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084128    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006269.1-6631s1c1
Sequence:CCGGGCACACTCATTCTTTGTCAATCTCGAGATTGACAAAGAATGAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006269.1-5901s1c1
Sequence:CCGGGCCCAATACTAACTGTTATTACTCGAGTAATAACAGTTAGTATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006269.1-1132s1c1
Sequence:CCGGCGGCACTATGACAGTTGAGATCTCGAGATCTCAACTGTCATAGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006269.1-2858s1c1
Sequence:CCGGCCTGAGGCTATTGCTCATCATCTCGAGATGATGAGCAATAGCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006269.1-3350s1c1
Sequence:CCGGGCCATTCAAGTAGATCCTATACTCGAGTATAGGATCTACTTGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006269
RP1 MISSION shRNA shRNA Plasmid DNA
retinitis pigmentosa 1 (autosomal dominant)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084128    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006269.1-6631s1c1
Sequence:CCGGGCACACTCATTCTTTGTCAATCTCGAGATTGACAAAGAATGAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006269.1-5901s1c1
Sequence:CCGGGCCCAATACTAACTGTTATTACTCGAGTAATAACAGTTAGTATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006269.1-1132s1c1
Sequence:CCGGCGGCACTATGACAGTTGAGATCTCGAGATCTCAACTGTCATAGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006269.1-2858s1c1
Sequence:CCGGCCTGAGGCTATTGCTCATCATCTCGAGATGATGAGCAATAGCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006269.1-3350s1c1
Sequence:CCGGGCCATTCAAGTAGATCCTATACTCGAGTATAGGATCTACTTGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006269
RP1 MISSION shRNA Lentiviral Transduction Particles
retinitis pigmentosa 1 (autosomal dominant)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084128    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006269.1-6631s1c1
Sequence:CCGGGCACACTCATTCTTTGTCAATCTCGAGATTGACAAAGAATGAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006269.1-5901s1c1
Sequence:CCGGGCCCAATACTAACTGTTATTACTCGAGTAATAACAGTTAGTATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006269.1-1132s1c1
Sequence:CCGGCGGCACTATGACAGTTGAGATCTCGAGATCTCAACTGTCATAGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006269.1-2858s1c1
Sequence:CCGGCCTGAGGCTATTGCTCATCATCTCGAGATGATGAGCAATAGCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006269.1-3350s1c1
Sequence:CCGGGCCATTCAAGTAGATCCTATACTCGAGTATAGGATCTACTTGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011283
RP1 MISSION shRNA Bacterial Glycerol Stock
retinitis pigmentosa 1 (autosomal dominant)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000105690    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011283.1-6518s1c1
Sequence:CCGGCCCTAATGAGTGGGATGATTTCTCGAGAAATCATCCCACTCATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011283.1-1094s1c1
Sequence:CCGGCCTGAGAATTACTTGGCCTTACTCGAGTAAGGCCAAGTAATTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011283.1-6232s1c1
Sequence:CCGGCCCTAGCAGTTGGACAGATAACTCGAGTTATCTGTCCAACTGCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011283.1-4173s1c1
Sequence:CCGGGCACTGATGATCTGGAATCAACTCGAGTTGATTCCAGATCATCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011283
RP1 MISSION shRNA shRNA Plasmid DNA
retinitis pigmentosa 1 (autosomal dominant)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000105690    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011283.1-6518s1c1
Sequence:CCGGCCCTAATGAGTGGGATGATTTCTCGAGAAATCATCCCACTCATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011283.1-1094s1c1
Sequence:CCGGCCTGAGAATTACTTGGCCTTACTCGAGTAAGGCCAAGTAATTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011283.1-6232s1c1
Sequence:CCGGCCCTAGCAGTTGGACAGATAACTCGAGTTATCTGTCCAACTGCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011283.1-4173s1c1
Sequence:CCGGGCACTGATGATCTGGAATCAACTCGAGTTGATTCCAGATCATCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011283
RP1 MISSION shRNA Lentiviral Transduction Particles
retinitis pigmentosa 1 (autosomal dominant)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000105690    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011283.1-6518s1c1
Sequence:CCGGCCCTAATGAGTGGGATGATTTCTCGAGAAATCATCCCACTCATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011283.1-1094s1c1
Sequence:CCGGCCTGAGAATTACTTGGCCTTACTCGAGTAAGGCCAAGTAATTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011283.1-6232s1c1
Sequence:CCGGCCCTAGCAGTTGGACAGATAACTCGAGTTATCTGTCCAACTGCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011283.1-4173s1c1
Sequence:CCGGGCACTGATGATCTGGAATCAACTCGAGTTGATTCCAGATCATCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks