EMAIL THIS PAGE TO A FRIEND

RP9

retinitis pigmentosa 9 (autosomal dominant)

Synonyms: PAP-1
UniProtKB ID: Q8TA86
Gene ID:
Human(6100) Summary: The protein encoded by this gene can be bound and phosphorylated by the protooncogene PIM1 product, a serine/threonine protein kinase . This protein localizes in nuclear speckles containing the splicing factors, and has a role in pre-mRNA splicing. CBF1-interacting protein (CIR), a corepressor of CBF1, can also bind to this protein and effects alternative splicing. Mutations in this gene result in autosomal dominant retinitis pigmentosa-9. This gene has a pseudogene (GeneID: 441212), which is located in tandem array approximately 166 kb distal to this gene. [provided by RefSeq, Sep 2009]
Mouse(55934) retinitis pigmentosa 9 (human)
Rat(363032) retinitis pigmentosa 9 (human)
Zebrafish(492481) retinitis pigmentosa 9 (autosomal dominant)
chicken(420747) retinitis pigmentosa 9 (autosomal dominant)
dog(100685166) retinitis pigmentosa 9 (autosomal dominant)
domestic cat(101096219) retinitis pigmentosa 9 (autosomal dominant)
cow(100336120) retinitis pigmentosa 9 (autosomal dominant)
sheep(101119636) retinitis pigmentosa 9 (autosomal dominant)
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018739 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018739 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018739 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_203288 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203288 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203288 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_203288 Rosetta Predictions human pricing
NM_001108756 Rosetta Predictions rat pricing
NM_018739 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203288 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186433 predicted 346
2 SASI_Hs01_00186437 predicted 345
3 SASI_Hs01_00186438 predicted 347
4 SASI_Hs02_00373193 predicted 198
5 SASI_Hs02_00373194 predicted 477
6 SASI_Hs02_00373195 predicted 213
7 SASI_Hs02_00373196 predicted 237
8 SASI_Hs02_00373197 predicted 240
9 SASI_Hs02_00373198 predicted 316
10 SASI_Hs02_00373199 predicted 252
11 SASI_Hs01_00186432 predicted 875
12 SASI_Hs01_00186434 predicted 852
13 SASI_Hs01_00186435 predicted 843
14 SASI_Hs01_00186436 predicted 899
15 SASI_Hs01_00186439 predicted 842
16 SASI_Hs01_00186440 predicted 895
17 SASI_Hs01_00186441 predicted 858
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108756 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241775 predicted 349
2 SASI_Rn02_00241776 predicted 445
3 SASI_Rn02_00241777 predicted 438
4 SASI_Rn02_00241778 predicted 404
5 SASI_Rn02_00241779 predicted 484
6 SASI_Rn02_00241780 predicted 486
7 SASI_Rn02_00241781 predicted 397
8 SASI_Rn02_00241782 predicted 318
9 SASI_Rn02_00241783 predicted 351
10 SASI_Rn02_00241784 predicted 484
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018739 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184611 predicted 354
2 SASI_Mm01_00184612 predicted 344
3 SASI_Mm01_00184613 predicted 409
4 SASI_Mm01_00184614 predicted 308
5 SASI_Mm01_00184615 predicted 397
6 SASI_Mm02_00323992 predicted 395
7 SASI_Mm01_00184616 predicted 318
8 SASI_Mm01_00184617 predicted 405
9 SASI_Mm01_00184618 predicted 209
10 SASI_Mm01_00184619 predicted 367
11 SASI_Mm01_00184610 predicted 307
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018739
VALIDATED
RP9 MISSION shRNA Bacterial Glycerol Stock
retinitis pigmentosa 9 (autosomal dominant)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018739.1-469s21c1
Sequence:CCGGGCCCTTTCTTTATCAAAGGCACTCGAGTGCCTTTGATAAAGAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018739.1-515s21c1
Sequence:CCGGCGCACATGAAGATCCTATGTACTCGAGTACATAGGATCTTCATGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018739.1-403s21c1
Sequence:CCGGGAGAGGTCAAAGTTATGCAATCTCGAGATTGCATAACTTTGACCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018739.1-813s21c1
Sequence:CCGGCGAGAGTGAGAGACTGGACATCTCGAGATGTCCAGTCTCTCACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018739.1-458s21c1
Sequence:CCGGCGACAAAGAATGCCCTTTCTTCTCGAGAAGAAAGGGCATTCTTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126374    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018739.1-813s1c1
Sequence:CCGGCGAGAGTGAGAGACTGGACATCTCGAGATGTCCAGTCTCTCACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018739.1-469s1c1
Sequence:CCGGGCCCTTTCTTTATCAAAGGCACTCGAGTGCCTTTGATAAAGAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018739.1-515s1c1
Sequence:CCGGCGCACATGAAGATCCTATGTACTCGAGTACATAGGATCTTCATGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018739.1-403s1c1
Sequence:CCGGGAGAGGTCAAAGTTATGCAATCTCGAGATTGCATAACTTTGACCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018739.1-458s1c1
Sequence:CCGGCGACAAAGAATGCCCTTTCTTCTCGAGAAGAAAGGGCATTCTTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018739
VALIDATED
RP9 MISSION shRNA shRNA Plasmid DNA
retinitis pigmentosa 9 (autosomal dominant)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018739.1-469s21c1
Sequence:CCGGGCCCTTTCTTTATCAAAGGCACTCGAGTGCCTTTGATAAAGAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018739.1-515s21c1
Sequence:CCGGCGCACATGAAGATCCTATGTACTCGAGTACATAGGATCTTCATGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018739.1-403s21c1
Sequence:CCGGGAGAGGTCAAAGTTATGCAATCTCGAGATTGCATAACTTTGACCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018739.1-813s21c1
Sequence:CCGGCGAGAGTGAGAGACTGGACATCTCGAGATGTCCAGTCTCTCACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018739.1-458s21c1
Sequence:CCGGCGACAAAGAATGCCCTTTCTTCTCGAGAAGAAAGGGCATTCTTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126374    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018739.1-813s1c1
Sequence:CCGGCGAGAGTGAGAGACTGGACATCTCGAGATGTCCAGTCTCTCACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018739.1-469s1c1
Sequence:CCGGGCCCTTTCTTTATCAAAGGCACTCGAGTGCCTTTGATAAAGAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018739.1-515s1c1
Sequence:CCGGCGCACATGAAGATCCTATGTACTCGAGTACATAGGATCTTCATGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018739.1-403s1c1
Sequence:CCGGGAGAGGTCAAAGTTATGCAATCTCGAGATTGCATAACTTTGACCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018739.1-458s1c1
Sequence:CCGGCGACAAAGAATGCCCTTTCTTCTCGAGAAGAAAGGGCATTCTTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018739
VALIDATED
RP9 MISSION shRNA Lentiviral Transduction Particles
retinitis pigmentosa 9 (autosomal dominant)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018739.1-469s21c1
Sequence:CCGGGCCCTTTCTTTATCAAAGGCACTCGAGTGCCTTTGATAAAGAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018739.1-515s21c1
Sequence:CCGGCGCACATGAAGATCCTATGTACTCGAGTACATAGGATCTTCATGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018739.1-403s21c1
Sequence:CCGGGAGAGGTCAAAGTTATGCAATCTCGAGATTGCATAACTTTGACCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018739.1-813s21c1
Sequence:CCGGCGAGAGTGAGAGACTGGACATCTCGAGATGTCCAGTCTCTCACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018739.1-458s21c1
Sequence:CCGGCGACAAAGAATGCCCTTTCTTCTCGAGAAGAAAGGGCATTCTTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126374    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018739.1-813s1c1
Sequence:CCGGCGAGAGTGAGAGACTGGACATCTCGAGATGTCCAGTCTCTCACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018739.1-469s1c1
Sequence:CCGGGCCCTTTCTTTATCAAAGGCACTCGAGTGCCTTTGATAAAGAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018739.1-515s1c1
Sequence:CCGGCGCACATGAAGATCCTATGTACTCGAGTACATAGGATCTTCATGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018739.1-403s1c1
Sequence:CCGGGAGAGGTCAAAGTTATGCAATCTCGAGATTGCATAACTTTGACCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018739.1-458s1c1
Sequence:CCGGCGACAAAGAATGCCCTTTCTTCTCGAGAAGAAAGGGCATTCTTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203288
RP9 MISSION shRNA Bacterial Glycerol Stock
retinitis pigmentosa 9 (autosomal dominant)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203288.1-925s21c1
Sequence:CCGGCCTGCTGGTCACATGAGTTTACTCGAGTAAACTCATGTGACCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203288.1-454s21c1
Sequence:CCGGCGAGACAATAAACGACATGAACTCGAGTTCATGTCGTTTATTGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203288.1-480s21c1
Sequence:CCGGCGTAAGGATACAGCAGTTAAACTCGAGTTTAACTGCTGTATCCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203288.1-424s21c1
Sequence:CCGGGCACATGAAGATCCCATGTATCTCGAGATACATGGGATCTTCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203288.1-925s1c1
Sequence:CCGGCCTGCTGGTCACATGAGTTTACTCGAGTAAACTCATGTGACCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203288.1-454s1c1
Sequence:CCGGCGAGACAATAAACGACATGAACTCGAGTTCATGTCGTTTATTGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203288.1-479s1c1
Sequence:CCGGACGTAAGGATACAGCAGTTAACTCGAGTTAACTGCTGTATCCTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203288.1-480s1c1
Sequence:CCGGCGTAAGGATACAGCAGTTAAACTCGAGTTTAACTGCTGTATCCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203288.1-424s1c1
Sequence:CCGGGCACATGAAGATCCCATGTATCTCGAGATACATGGGATCTTCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203288
RP9 MISSION shRNA shRNA Plasmid DNA
retinitis pigmentosa 9 (autosomal dominant)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203288.1-925s21c1
Sequence:CCGGCCTGCTGGTCACATGAGTTTACTCGAGTAAACTCATGTGACCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203288.1-454s21c1
Sequence:CCGGCGAGACAATAAACGACATGAACTCGAGTTCATGTCGTTTATTGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203288.1-480s21c1
Sequence:CCGGCGTAAGGATACAGCAGTTAAACTCGAGTTTAACTGCTGTATCCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203288.1-424s21c1
Sequence:CCGGGCACATGAAGATCCCATGTATCTCGAGATACATGGGATCTTCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203288.1-925s1c1
Sequence:CCGGCCTGCTGGTCACATGAGTTTACTCGAGTAAACTCATGTGACCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203288.1-454s1c1
Sequence:CCGGCGAGACAATAAACGACATGAACTCGAGTTCATGTCGTTTATTGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203288.1-479s1c1
Sequence:CCGGACGTAAGGATACAGCAGTTAACTCGAGTTAACTGCTGTATCCTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203288.1-480s1c1
Sequence:CCGGCGTAAGGATACAGCAGTTAAACTCGAGTTTAACTGCTGTATCCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203288.1-424s1c1
Sequence:CCGGGCACATGAAGATCCCATGTATCTCGAGATACATGGGATCTTCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203288
RP9 MISSION shRNA Lentiviral Transduction Particles
retinitis pigmentosa 9 (autosomal dominant)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203288.1-925s21c1
Sequence:CCGGCCTGCTGGTCACATGAGTTTACTCGAGTAAACTCATGTGACCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203288.1-454s21c1
Sequence:CCGGCGAGACAATAAACGACATGAACTCGAGTTCATGTCGTTTATTGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203288.1-480s21c1
Sequence:CCGGCGTAAGGATACAGCAGTTAAACTCGAGTTTAACTGCTGTATCCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203288.1-424s21c1
Sequence:CCGGGCACATGAAGATCCCATGTATCTCGAGATACATGGGATCTTCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203288.1-925s1c1
Sequence:CCGGCCTGCTGGTCACATGAGTTTACTCGAGTAAACTCATGTGACCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203288.1-454s1c1
Sequence:CCGGCGAGACAATAAACGACATGAACTCGAGTTCATGTCGTTTATTGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203288.1-479s1c1
Sequence:CCGGACGTAAGGATACAGCAGTTAACTCGAGTTAACTGCTGTATCCTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203288.1-480s1c1
Sequence:CCGGCGTAAGGATACAGCAGTTAAACTCGAGTTTAACTGCTGTATCCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203288.1-424s1c1
Sequence:CCGGGCACATGAAGATCCCATGTATCTCGAGATACATGGGATCTTCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks