EMAIL THIS PAGE TO A FRIEND

RPA2

replication protein A2, 32kDa

Synonyms: REPA2 RPA32
UniProtKB ID: P15927, Q52II0, Q5TEI9, Q5TEJ5
Gene ID:
Mouse(19891) replication protein A2
Rat(59102) replication protein A2
fruit fly(35364) Replication protein A2
Thale Cress(816985) replicon protein A2
chicken(419566) replication protein A2, 32kDa
domestic cat(101084979) replication protein A2, 32kDa
dog(487339) replication protein A2, 32kDa
Zebrafish(65226) replication protein A2
cow(507912) replication protein A2, 32kDa
sheep(101105309) replication protein A2, 32kDa
naked mole-rat(101708546) replication protein A2, 32kDa
domestic guinea pig(100721250) replication protein A2, 32kDa
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4504725 Anti-phospho-RFA2 (pSer33) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4504205 Anti-phospho-RFA2 (pThr21) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4301556 Anti-phospho-RFA2 (pThr21) antibody produced in rabbit affinity isolated antibody rat, human
western blot pricing
SAB4502652 Anti-RFA2, N-Terminal antibody produced in rabbit affinity isolated antibody mouse, human
immunohistochemistry, western blot pricing
SAB1406400 Anti-RPA2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA026306 Anti-RPA2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab1 human
immunofluorescence, immunohistochemistry, western blot pricing
HPA026309 Anti-RPA2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab2 human
immunofluorescence, immunohistochemistry, western blot pricing
PLA0298 Goat anti-RPA32 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human
proximity ligation assay, western blot pricing
R1280 Monoclonal Anti-RPA/p34 antibody produced in mouse ~2 mg/mL, clone 9H8, purified immunoglobulin, buffered aqueous solution monkey, human
immunocytochemistry, immunoprecipitation, western blot pricing
SAB2702160 Monoclonal Anti-RPA2 antibody produced in mouse mouse, human
immunocytochemistry, immunofluorescence, immunoprecipitation, western blot pricing
PLA0310 Rabbit anti-Phospho RPA32 (S33) Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. primate, rhesus monkey, gibbon, mouse, chimpanzee, human, gorilla
proximity ligation assay, western blot pricing
PLA0071 Rabbit anti-Phospho RPA32 (S4/S8) Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human, rhesus monkey, gorilla, primate, mouse, marmoset
immunofluorescence, immunohistochemistry, immunoprecipitation, proximity ligation assay, western blot pricing
PLA0070 Rabbit anti-RPA32 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. rabbit, chimpanzee, gorilla, human, horse, pig, marmoset, rhesus monkey, gibbon, mouse
immunofluorescence, immunohistochemistry, immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011284 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011284 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011284 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002946 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002946 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002946 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU083931 MISSION® esiRNA esiRNA targeting mouse Rpa2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002946 Rosetta Predictions human pricing
NM_021582 Rosetta Predictions rat pricing
NM_011284 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002946 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095278 predicted 1184
2 SASI_Hs01_00095279 predicted 1093
3 SASI_Hs01_00095280 predicted 774
4 SASI_Hs01_00095281 predicted 445
5 SASI_Hs01_00095282 predicted 412
6 SASI_Hs01_00095283 predicted 1191
7 SASI_Hs02_00334789 predicted 1092
8 SASI_Hs01_00095284 predicted 525
9 SASI_Hs01_00095285 predicted 1040
10 SASI_Hs01_00095286 predicted 1179
11 SASI_Hs01_00095287 predicted 465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021582 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098068 predicted 258
2 SASI_Rn02_00262612 predicted 507
3 SASI_Rn01_00098070 predicted 653
4 SASI_Rn01_00098071 predicted 964
5 SASI_Rn01_00098072 predicted 546
6 SASI_Rn01_00098073 predicted 754
7 SASI_Rn01_00098074 predicted 210
8 SASI_Rn01_00098075 predicted 302
9 SASI_Rn01_00098076 predicted 338
10 SASI_Rn02_00262613 predicted 571
11 SASI_Rn01_00098069 predicted 844
12 SASI_Rn01_00098077 predicted 418
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011284 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320329 predicted 801
2 SASI_Mm01_00173504 predicted 351
3 SASI_Mm01_00173505 predicted 355
4 SASI_Mm01_00173507 predicted 1000
5 SASI_Mm01_00173511 predicted 559
6 SASI_Mm02_00320330 predicted 1000
7 SASI_Mm02_00320331 predicted 355
8 SASI_Mm02_00320332 predicted 801
9 SASI_Mm02_00320333 predicted 724
10 SASI_Mm02_00320334 predicted 863
11 SASI_Mm01_00173503 predicted 277
12 SASI_Mm01_00173506 predicted 806
13 SASI_Mm01_00173508 predicted 521
14 SASI_Mm01_00173509 predicted 321
15 SASI_Mm01_00173510 predicted 990
16 SASI_Mm01_00173512 predicted 300
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011284
RPA2 MISSION shRNA Bacterial Glycerol Stock
replication protein A2, 32kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011284.3-459s21c1
Sequence:CCGGCTCCCGAAACATACGTGAAAGCTCGAGCTTTCACGTATGTTTCGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011284.3-367s21c1
Sequence:CCAGTGTTTACAAGATAGACGATATCTCGAGATATCGTCTATCTTGTAAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011284.3-1172s21c1
Sequence:CCGGAGGATGGGTGGTCGGAATTGACTCGAGTCAATTCCGACCACCCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011284.3-844s21c1
Sequence:CCGGGTGCAACGAGGGCCACATTTACTCGAGTAAATGTGGCCCTCGTTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011284.3-1117s21c1
Sequence:CCGGAGTAAACCAGGACTGGATTTCCTCGAGGAAATCCAGTCCTGGTTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119937    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011284.2-1364s1c1
Sequence:CCGGGCACTTTCCTTCCCTTGTCTTCTCGAGAAGACAAGGGAAGGAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011284.2-290s1c1
Sequence:CCGGGAATTGGAGATGTCGAGATTTCTCGAGAAATCTCGACATCTCCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011284.2-880s1c1
Sequence:CCGGGATCACTTTAAGTCTACAGATCTCGAGATCTGTAGACTTAAAGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011284.2-684s1c1
Sequence:CCGGGAATAACTTCATGCCAGCAAACTCGAGTTTGCTGGCATGAAGTTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011284.2-224s1c1
Sequence:CCGGCCCAGCATATTGTGCCCTGTACTCGAGTACAGGGCACAATATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011284
RPA2 MISSION shRNA shRNA Plasmid DNA
replication protein A2, 32kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011284.3-459s21c1
Sequence:CCGGCTCCCGAAACATACGTGAAAGCTCGAGCTTTCACGTATGTTTCGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011284.3-367s21c1
Sequence:CCAGTGTTTACAAGATAGACGATATCTCGAGATATCGTCTATCTTGTAAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011284.3-1172s21c1
Sequence:CCGGAGGATGGGTGGTCGGAATTGACTCGAGTCAATTCCGACCACCCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011284.3-844s21c1
Sequence:CCGGGTGCAACGAGGGCCACATTTACTCGAGTAAATGTGGCCCTCGTTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011284.3-1117s21c1
Sequence:CCGGAGTAAACCAGGACTGGATTTCCTCGAGGAAATCCAGTCCTGGTTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119937    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011284.2-1364s1c1
Sequence:CCGGGCACTTTCCTTCCCTTGTCTTCTCGAGAAGACAAGGGAAGGAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011284.2-290s1c1
Sequence:CCGGGAATTGGAGATGTCGAGATTTCTCGAGAAATCTCGACATCTCCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011284.2-880s1c1
Sequence:CCGGGATCACTTTAAGTCTACAGATCTCGAGATCTGTAGACTTAAAGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011284.2-684s1c1
Sequence:CCGGGAATAACTTCATGCCAGCAAACTCGAGTTTGCTGGCATGAAGTTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011284.2-224s1c1
Sequence:CCGGCCCAGCATATTGTGCCCTGTACTCGAGTACAGGGCACAATATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011284
RPA2 MISSION shRNA Lentiviral Transduction Particles
replication protein A2, 32kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011284.3-459s21c1
Sequence:CCGGCTCCCGAAACATACGTGAAAGCTCGAGCTTTCACGTATGTTTCGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011284.3-367s21c1
Sequence:CCAGTGTTTACAAGATAGACGATATCTCGAGATATCGTCTATCTTGTAAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011284.3-1172s21c1
Sequence:CCGGAGGATGGGTGGTCGGAATTGACTCGAGTCAATTCCGACCACCCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011284.3-844s21c1
Sequence:CCGGGTGCAACGAGGGCCACATTTACTCGAGTAAATGTGGCCCTCGTTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011284.3-1117s21c1
Sequence:CCGGAGTAAACCAGGACTGGATTTCCTCGAGGAAATCCAGTCCTGGTTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119937    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011284.2-1364s1c1
Sequence:CCGGGCACTTTCCTTCCCTTGTCTTCTCGAGAAGACAAGGGAAGGAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011284.2-290s1c1
Sequence:CCGGGAATTGGAGATGTCGAGATTTCTCGAGAAATCTCGACATCTCCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011284.2-880s1c1
Sequence:CCGGGATCACTTTAAGTCTACAGATCTCGAGATCTGTAGACTTAAAGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011284.2-684s1c1
Sequence:CCGGGAATAACTTCATGCCAGCAAACTCGAGTTTGCTGGCATGAAGTTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011284.2-224s1c1
Sequence:CCGGCCCAGCATATTGTGCCCTGTACTCGAGTACAGGGCACAATATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002946
VALIDATED
RPA2 MISSION shRNA Bacterial Glycerol Stock
replication protein A2, 32kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231924    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002946.3-1195s21c1
Sequence:CCGGAGTAGGTTTCATCTATCAAATCTCGAGATTTGATAGATGAAACCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002946.3-1086s21c1
Sequence:CCGGTGCAGAATAACTGGATCTAACCTCGAGGTTAGATCCAGTTATTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002946.3-755s21c1
Sequence:CCGGATATTCTGGAAGTGATCAATGCTCGAGCATTGATCACTTCCAGAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002946.3-491s21c1
Sequence:CCGGAGATTTCACAGGTCACTATTGCTCGAGCAATAGTGACCTGTGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002946.3-416s21c1
Sequence:CCGGACATTGTGCCCTGTACTATATCTCGAGATATAGTACAGGGCACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002946.3-1004s1c1
Sequence:CCGGCAATCAAGCAAGCTGTGGATTCTCGAGAATCCACAGCTTGCTTGATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_002946.3-371s1c1
Sequence:CCGGCCGCACCTTCTCAAGCCGAAACTCGAGTTTCGGCTTGAGAAGGTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002946.3-775s1c1
Sequence:CCGGGCACACATGGTACTAAGCAAACTCGAGTTTGCTTAGTACCATGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_002946.3-912s1c1
Sequence:CCGGCCAGGTGTTGAATTTGATTAACTCGAGTTAATCAAATTCAACACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005986    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_002946.3-1346s1c1
Sequence:CCGGGCTTGTTACAACATCAAGATACTCGAGTATCTTGATGTTGTAACAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002946
VALIDATED
RPA2 MISSION shRNA shRNA Plasmid DNA
replication protein A2, 32kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231924    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002946.3-1195s21c1
Sequence:CCGGAGTAGGTTTCATCTATCAAATCTCGAGATTTGATAGATGAAACCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002946.3-1086s21c1
Sequence:CCGGTGCAGAATAACTGGATCTAACCTCGAGGTTAGATCCAGTTATTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002946.3-755s21c1
Sequence:CCGGATATTCTGGAAGTGATCAATGCTCGAGCATTGATCACTTCCAGAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002946.3-491s21c1
Sequence:CCGGAGATTTCACAGGTCACTATTGCTCGAGCAATAGTGACCTGTGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002946.3-416s21c1
Sequence:CCGGACATTGTGCCCTGTACTATATCTCGAGATATAGTACAGGGCACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002946.3-1004s1c1
Sequence:CCGGCAATCAAGCAAGCTGTGGATTCTCGAGAATCCACAGCTTGCTTGATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_002946.3-371s1c1
Sequence:CCGGCCGCACCTTCTCAAGCCGAAACTCGAGTTTCGGCTTGAGAAGGTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002946.3-775s1c1
Sequence:CCGGGCACACATGGTACTAAGCAAACTCGAGTTTGCTTAGTACCATGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_002946.3-912s1c1
Sequence:CCGGCCAGGTGTTGAATTTGATTAACTCGAGTTAATCAAATTCAACACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005986    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_002946.3-1346s1c1
Sequence:CCGGGCTTGTTACAACATCAAGATACTCGAGTATCTTGATGTTGTAACAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002946
VALIDATED
RPA2 MISSION shRNA Lentiviral Transduction Particles
replication protein A2, 32kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231924    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002946.3-1195s21c1
Sequence:CCGGAGTAGGTTTCATCTATCAAATCTCGAGATTTGATAGATGAAACCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002946.3-1086s21c1
Sequence:CCGGTGCAGAATAACTGGATCTAACCTCGAGGTTAGATCCAGTTATTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002946.3-755s21c1
Sequence:CCGGATATTCTGGAAGTGATCAATGCTCGAGCATTGATCACTTCCAGAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002946.3-491s21c1
Sequence:CCGGAGATTTCACAGGTCACTATTGCTCGAGCAATAGTGACCTGTGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002946.3-416s21c1
Sequence:CCGGACATTGTGCCCTGTACTATATCTCGAGATATAGTACAGGGCACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002946.3-1004s1c1
Sequence:CCGGCAATCAAGCAAGCTGTGGATTCTCGAGAATCCACAGCTTGCTTGATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_002946.3-371s1c1
Sequence:CCGGCCGCACCTTCTCAAGCCGAAACTCGAGTTTCGGCTTGAGAAGGTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002946.3-775s1c1
Sequence:CCGGGCACACATGGTACTAAGCAAACTCGAGTTTGCTTAGTACCATGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_002946.3-912s1c1
Sequence:CCGGCCAGGTGTTGAATTTGATTAACTCGAGTTAATCAAATTCAACACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005986    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_002946.3-1346s1c1
Sequence:CCGGGCTTGTTACAACATCAAGATACTCGAGTATCTTGATGTTGTAACAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks