EMAIL THIS PAGE TO A FRIEND

RPA4

replication protein A4, 30kDa

Synonyms: HSU24186
Species: Human RPA4(29935)
UniProtKB ID: Q13156, Q3SY03
Gene ID:
Human(29935) Summary: This gene encodes a single-stranded DNA-binding protein that is the 30-kDa subunit of the replication protein A complex. Replication protein A is an essential factor for DNA double-strand break repair and cell cycle checkpoint activation. The encoded protein localizes to DNA repair foci and may be involved in the cellular DNA damage response. This protein may also play a role in inhibiting viral replication.[provided by RefSeq, Apr 2010]
22 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013347 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013347 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013347 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU103181 MISSION® esiRNA esiRNA human RPA4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013347 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013347 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169975 predicted 481
2 SASI_Hs01_00169976 predicted 683
3 SASI_Hs01_00169977 predicted 749
4 SASI_Hs01_00169978 predicted 917
5 SASI_Hs01_00169979 predicted 538
6 SASI_Hs01_00169980 predicted 775
7 SASI_Hs01_00169981 predicted 560
8 SASI_Hs01_00169982 predicted 661
9 SASI_Hs01_00169983 predicted 513
10 SASI_Hs01_00169984 predicted 866
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013347
RPA4 MISSION shRNA Bacterial Glycerol Stock
replication protein A4, 30kDa
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013347.3-876s21c1
Sequence:CCGGACGATGAGAGTCACCGCAATTCTCGAGAATTGCGGTGACTCTCATCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013347.3-1122s21c1
Sequence:CCGGGCATCCAGCTGTGAGTAATTTCTCGAGAAATTACTCACAGCTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013347.3-768s21c1
Sequence:CCGGATATTCTGGAAACGGTCAATGCTCGAGCATTGACCGTTTCCAGAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013347.1-1105s1c1
Sequence:CCGGCCATCAAGGAAGCGATTGATTCTCGAGAATCAATCGCTTCCTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013347.1-1116s1c1
Sequence:CCGGGCGATTGATTATCTGACCGTTCTCGAGAACGGTCAGATAATCAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013347.1-1106s1c1
Sequence:CCGGCATCAAGGAAGCGATTGATTACTCGAGTAATCAATCGCTTCCTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013347.1-767s1c1
Sequence:CCGGCGGAGTATATGTCAAAGTGTTCTCGAGAACACTTTGACATATACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162642    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013347.1-1410s1c1
Sequence:CCGGCTAGCAAGCTAATGGAAACATCTCGAGATGTTTCCATTAGCTTGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013347.1-919s1c1
Sequence:CCGGGTCGTGATACCACTGTAGAAACTCGAGTTTCTACAGTGGTATCACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161010    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013347.1-1400s1c1
Sequence:CCGGGTAGGATTTACTAGCAAGCTACTCGAGTAGCTTGCTAGTAAATCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160753    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013347.1-1375s1c1
Sequence:CCGGCGGTGATGGATAAATTGACAACTCGAGTTGTCAATTTATCCATCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013347
RPA4 MISSION shRNA shRNA Plasmid DNA
replication protein A4, 30kDa
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013347.3-876s21c1
Sequence:CCGGACGATGAGAGTCACCGCAATTCTCGAGAATTGCGGTGACTCTCATCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013347.3-1122s21c1
Sequence:CCGGGCATCCAGCTGTGAGTAATTTCTCGAGAAATTACTCACAGCTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013347.3-768s21c1
Sequence:CCGGATATTCTGGAAACGGTCAATGCTCGAGCATTGACCGTTTCCAGAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013347.1-1105s1c1
Sequence:CCGGCCATCAAGGAAGCGATTGATTCTCGAGAATCAATCGCTTCCTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013347.1-1116s1c1
Sequence:CCGGGCGATTGATTATCTGACCGTTCTCGAGAACGGTCAGATAATCAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013347.1-1106s1c1
Sequence:CCGGCATCAAGGAAGCGATTGATTACTCGAGTAATCAATCGCTTCCTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013347.1-767s1c1
Sequence:CCGGCGGAGTATATGTCAAAGTGTTCTCGAGAACACTTTGACATATACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162642    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013347.1-1410s1c1
Sequence:CCGGCTAGCAAGCTAATGGAAACATCTCGAGATGTTTCCATTAGCTTGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013347.1-919s1c1
Sequence:CCGGGTCGTGATACCACTGTAGAAACTCGAGTTTCTACAGTGGTATCACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161010    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013347.1-1400s1c1
Sequence:CCGGGTAGGATTTACTAGCAAGCTACTCGAGTAGCTTGCTAGTAAATCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160753    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013347.1-1375s1c1
Sequence:CCGGCGGTGATGGATAAATTGACAACTCGAGTTGTCAATTTATCCATCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013347
RPA4 MISSION shRNA Lentiviral Transduction Particles
replication protein A4, 30kDa
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013347.3-876s21c1
Sequence:CCGGACGATGAGAGTCACCGCAATTCTCGAGAATTGCGGTGACTCTCATCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013347.3-1122s21c1
Sequence:CCGGGCATCCAGCTGTGAGTAATTTCTCGAGAAATTACTCACAGCTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013347.3-768s21c1
Sequence:CCGGATATTCTGGAAACGGTCAATGCTCGAGCATTGACCGTTTCCAGAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013347.1-1105s1c1
Sequence:CCGGCCATCAAGGAAGCGATTGATTCTCGAGAATCAATCGCTTCCTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013347.1-1116s1c1
Sequence:CCGGGCGATTGATTATCTGACCGTTCTCGAGAACGGTCAGATAATCAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013347.1-1106s1c1
Sequence:CCGGCATCAAGGAAGCGATTGATTACTCGAGTAATCAATCGCTTCCTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013347.1-767s1c1
Sequence:CCGGCGGAGTATATGTCAAAGTGTTCTCGAGAACACTTTGACATATACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162642    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013347.1-1410s1c1
Sequence:CCGGCTAGCAAGCTAATGGAAACATCTCGAGATGTTTCCATTAGCTTGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013347.1-919s1c1
Sequence:CCGGGTCGTGATACCACTGTAGAAACTCGAGTTTCTACAGTGGTATCACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161010    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013347.1-1400s1c1
Sequence:CCGGGTAGGATTTACTAGCAAGCTACTCGAGTAGCTTGCTAGTAAATCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160753    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013347.1-1375s1c1
Sequence:CCGGCGGTGATGGATAAATTGACAACTCGAGTTGTCAATTTATCCATCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks