EMAIL THIS PAGE TO A FRIEND

RPGR

retinitis pigmentosa GTPase regulator

Synonyms: COD1 CORDX1 CRD PCDX RP15 RP3 XLRP3 orf15
Gene ID:
Human(6103) Summary: This gene encodes a protein with a series of six RCC1-like domains (RLDs), characteristic of the highly conserved guanine nucleotide exchange factors. The encoded protein is found in the Golgi body and interacts with RPGRIP1. This protein localizes to the outer segment of rod photoreceptors and is essential for their viability. Mutations in this gene have been associated with X-linked retinitis pigmentosa (XLRP). Multiple alternatively spliced transcript variants that encode different isoforms of this gene have been reported, but the full-length natures of only some have been determined. [provided by RefSeq, Dec 2008]
Mouse(19893) retinitis pigmentosa GTPase regulator
Rat(367733) retinitis pigmentosa GTPase regulator
chicken(418578) retinitis pigmentosa GTPase regulator
dog(403726) retinitis pigmentosa GTPase regulator
domestic cat(101087559) retinitis pigmentosa GTPase regulator
naked mole-rat(101708200) retinitis pigmentosa GTPase regulator
domestic guinea pig(100719690) retinitis pigmentosa GTPase regulator
cow(513263) retinitis pigmentosa GTPase regulator
sheep(101121323) retinitis pigmentosa GTPase regulator
sheep(554332) retinitis pigmentosa GTPase regulator
119 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000328 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000328 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000328 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011285 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011285 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011285 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000328 Rosetta Predictions human pricing
NM_001023582 Rosetta Predictions human pricing
NM_001034853 Rosetta Predictions human pricing
NM_001127601 Rosetta Predictions rat pricing
XM_346270 Rosetta Predictions rat pricing
NM_011285 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000328 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058822 predicted 1646
2 SASI_Hs01_00058824 predicted 1094
3 SASI_Hs01_00058825 predicted 1390
4 SASI_Hs01_00058826 predicted 1601
5 SASI_Hs01_00058827 predicted 896
6 SASI_Hs01_00058828 predicted 658
7 SASI_Hs01_00058829 predicted 624
8 SASI_Hs01_00058830 predicted 1632
9 SASI_Hs02_00302340 predicted 1035
10 SASI_Hs02_00302341 predicted 395
11 SASI_Hs01_00058821 predicted 1619
12 SASI_Hs01_00058823 predicted 1683
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001023582 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061321 predicted 1613
2 SASI_Hs01_00061322 predicted 1650
3 SASI_Hs01_00061323 predicted 1680
4 SASI_Hs01_00061324 predicted 1101
5 SASI_Hs01_00061325 predicted 1386
6 SASI_Hs01_00061326 predicted 1607
7 SASI_Hs01_00061327 predicted 904
8 SASI_Hs01_00061328 predicted 666
9 SASI_Hs01_00061329 predicted 633
10 SASI_Hs01_00061330 predicted 1631
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034853 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159671 predicted 1645
2 SASI_Hs01_00159673 predicted 1098
3 SASI_Hs01_00159674 predicted 1389
4 SASI_Hs01_00159675 predicted 1601
5 SASI_Hs01_00159676 predicted 896
6 SASI_Hs01_00159677 predicted 660
7 SASI_Hs01_00159678 predicted 625
8 SASI_Hs01_00159679 predicted 1631
9 SASI_Hs02_00308151 predicted 1037
10 SASI_Hs02_00308152 predicted 398
11 SASI_Hs01_00159670 predicted 1616
12 SASI_Hs01_00159672 predicted 1682
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127601 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254610 predicted 1263
2 SASI_Rn02_00254611 predicted 1129
3 SASI_Rn02_00254612 predicted 1232
4 SASI_Rn02_00254613 predicted 303
5 SASI_Rn02_00254614 predicted 532
6 SASI_Rn02_00254615 predicted 489
7 SASI_Rn02_00254616 predicted 1024
8 SASI_Rn02_00254617 predicted 2038
9 SASI_Rn02_00254618 predicted 608
10 SASI_Rn02_00254619 predicted 505
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_346270 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00187013 predicted 570
2 SASI_Rn01_00187014 predicted 498
3 SASI_Rn01_00187015 predicted 314
4 SASI_Rn01_00187016 predicted 784
5 SASI_Rn01_00187017 predicted 526
6 SASI_Rn01_00187018 predicted 492
7 SASI_Rn01_00187019 predicted 439
8 SASI_Rn01_00187020 predicted 605
9 SASI_Rn01_00187021 predicted 649
10 SASI_Rn01_00187022 predicted 417
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011285 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095654 predicted 1275
2 SASI_Mm01_00095655 predicted 1242
3 SASI_Mm01_00095656 predicted 1266
4 SASI_Mm02_00320335 predicted 450
5 SASI_Mm01_00095658 predicted 1060
6 SASI_Mm01_00095659 predicted 549
7 SASI_Mm01_00095661 predicted 699
8 SASI_Mm01_00095662 predicted 666
9 SASI_Mm01_00095663 predicted 357
10 SASI_Mm02_00320336 predicted 1167
11 SASI_Mm01_00095657 predicted 1047
12 SASI_Mm01_00095660 predicted 241
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000328
VALIDATED
RPGR MISSION shRNA Bacterial Glycerol Stock
retinitis pigmentosa GTPase regulator
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000328.2-599s21c1
Sequence:CCGGAGCTGTCTGCTGGATCTAATACTCGAGTATTAGATCCAGCAGACAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000328.2-1185s21c1
Sequence:CCGGTCCTACTTTGTGCTCTAATTTCTCGAGAAATTAGAGCACAAAGTAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000328.1-637s1c1
Sequence:CCGGCCTGGATCTCTTGTGGATATTCTCGAGAATATCCACAAGAGATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_000328.1-138s1c1
Sequence:CCGGCCCGGTAAATTCTGGTTTAAACTCGAGTTTAAACCAGAATTTACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_000328.1-2175s1c1
Sequence:CCGGCGGGCCATTTGTGAGTACAATCTCGAGATTGTACTCACAAATGGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000328.1-1344s1c1
Sequence:CCGGCCTCCAATAGAAGGGACTCTTCTCGAGAAGAGTCCCTTCTATTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_000328.1-1776s1c1
Sequence:CCGGGCTACGACTATCGAAGCATTTCTCGAGAAATGCTTCGATAGTCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000328
VALIDATED
RPGR MISSION shRNA shRNA Plasmid DNA
retinitis pigmentosa GTPase regulator
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000328.2-599s21c1
Sequence:CCGGAGCTGTCTGCTGGATCTAATACTCGAGTATTAGATCCAGCAGACAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000328.2-1185s21c1
Sequence:CCGGTCCTACTTTGTGCTCTAATTTCTCGAGAAATTAGAGCACAAAGTAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000328.1-637s1c1
Sequence:CCGGCCTGGATCTCTTGTGGATATTCTCGAGAATATCCACAAGAGATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_000328.1-138s1c1
Sequence:CCGGCCCGGTAAATTCTGGTTTAAACTCGAGTTTAAACCAGAATTTACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_000328.1-2175s1c1
Sequence:CCGGCGGGCCATTTGTGAGTACAATCTCGAGATTGTACTCACAAATGGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000328.1-1344s1c1
Sequence:CCGGCCTCCAATAGAAGGGACTCTTCTCGAGAAGAGTCCCTTCTATTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_000328.1-1776s1c1
Sequence:CCGGGCTACGACTATCGAAGCATTTCTCGAGAAATGCTTCGATAGTCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000328
VALIDATED
RPGR MISSION shRNA Lentiviral Transduction Particles
retinitis pigmentosa GTPase regulator
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000328.2-599s21c1
Sequence:CCGGAGCTGTCTGCTGGATCTAATACTCGAGTATTAGATCCAGCAGACAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000328.2-1185s21c1
Sequence:CCGGTCCTACTTTGTGCTCTAATTTCTCGAGAAATTAGAGCACAAAGTAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000328.1-637s1c1
Sequence:CCGGCCTGGATCTCTTGTGGATATTCTCGAGAATATCCACAAGAGATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_000328.1-138s1c1
Sequence:CCGGCCCGGTAAATTCTGGTTTAAACTCGAGTTTAAACCAGAATTTACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_000328.1-2175s1c1
Sequence:CCGGCGGGCCATTTGTGAGTACAATCTCGAGATTGTACTCACAAATGGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000328.1-1344s1c1
Sequence:CCGGCCTCCAATAGAAGGGACTCTTCTCGAGAAGAGTCCCTTCTATTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_000328.1-1776s1c1
Sequence:CCGGGCTACGACTATCGAAGCATTTCTCGAGAAATGCTTCGATAGTCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011285
VALIDATED
RPGR MISSION shRNA Bacterial Glycerol Stock
retinitis pigmentosa GTPase regulator
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317984    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011285.1-2287s21c1
Sequence:CCGGCCGAGCACATTTGTTCTTCATCTCGAGATGAAGAACAAATGTGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011285.1-1257s21c1
Sequence:CCGGCCTAAATTTGAAGACGTATATCTCGAGATATACGTCTTCAAATTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011285.1-441s21c1
Sequence:CCGGACAGATACTGGTGGCGTATATCTCGAGATATACGCCACCAGTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011285.1-1936s21c1
Sequence:CCGGCCCTTCGTGAGTACAATGAAACTCGAGTTTCATTGTACTCACGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011285.1-714s21c1
Sequence:CCGGTGGATCTCTTGTGGATATTACCTCGAGGTAATATCCACAAGAGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110090    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011285.1-2287s1c1
Sequence:CCGGCCGAGCACATTTGTTCTTCATCTCGAGATGAAGAACAAATGTGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011285.1-1101s1c1
Sequence:CCGGCGACATGGAAAGTTAGGACTTCTCGAGAAGTCCTAACTTTCCATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011285.1-1936s1c1
Sequence:CCGGCCCTTCGTGAGTACAATGAAACTCGAGTTTCATTGTACTCACGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011285.1-2151s1c1
Sequence:CCGGGCCTTACAAAGTGATAAGAAACTCGAGTTTCTTATCACTTTGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011285.1-2059s1c1
Sequence:CCGGCCTTCTTTAATCGGATGTCATCTCGAGATGACATCCGATTAAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011285
VALIDATED
RPGR MISSION shRNA shRNA Plasmid DNA
retinitis pigmentosa GTPase regulator
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317984    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011285.1-2287s21c1
Sequence:CCGGCCGAGCACATTTGTTCTTCATCTCGAGATGAAGAACAAATGTGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011285.1-1257s21c1
Sequence:CCGGCCTAAATTTGAAGACGTATATCTCGAGATATACGTCTTCAAATTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011285.1-441s21c1
Sequence:CCGGACAGATACTGGTGGCGTATATCTCGAGATATACGCCACCAGTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011285.1-1936s21c1
Sequence:CCGGCCCTTCGTGAGTACAATGAAACTCGAGTTTCATTGTACTCACGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011285.1-714s21c1
Sequence:CCGGTGGATCTCTTGTGGATATTACCTCGAGGTAATATCCACAAGAGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110090    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011285.1-2287s1c1
Sequence:CCGGCCGAGCACATTTGTTCTTCATCTCGAGATGAAGAACAAATGTGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011285.1-1101s1c1
Sequence:CCGGCGACATGGAAAGTTAGGACTTCTCGAGAAGTCCTAACTTTCCATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011285.1-1936s1c1
Sequence:CCGGCCCTTCGTGAGTACAATGAAACTCGAGTTTCATTGTACTCACGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011285.1-2151s1c1
Sequence:CCGGGCCTTACAAAGTGATAAGAAACTCGAGTTTCTTATCACTTTGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011285.1-2059s1c1
Sequence:CCGGCCTTCTTTAATCGGATGTCATCTCGAGATGACATCCGATTAAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011285
VALIDATED
RPGR MISSION shRNA Lentiviral Transduction Particles
retinitis pigmentosa GTPase regulator
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317984    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011285.1-2287s21c1
Sequence:CCGGCCGAGCACATTTGTTCTTCATCTCGAGATGAAGAACAAATGTGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011285.1-1257s21c1
Sequence:CCGGCCTAAATTTGAAGACGTATATCTCGAGATATACGTCTTCAAATTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011285.1-441s21c1
Sequence:CCGGACAGATACTGGTGGCGTATATCTCGAGATATACGCCACCAGTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011285.1-1936s21c1
Sequence:CCGGCCCTTCGTGAGTACAATGAAACTCGAGTTTCATTGTACTCACGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011285.1-714s21c1
Sequence:CCGGTGGATCTCTTGTGGATATTACCTCGAGGTAATATCCACAAGAGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110090    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011285.1-2287s1c1
Sequence:CCGGCCGAGCACATTTGTTCTTCATCTCGAGATGAAGAACAAATGTGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011285.1-1101s1c1
Sequence:CCGGCGACATGGAAAGTTAGGACTTCTCGAGAAGTCCTAACTTTCCATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011285.1-1936s1c1
Sequence:CCGGCCCTTCGTGAGTACAATGAAACTCGAGTTTCATTGTACTCACGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011285.1-2151s1c1
Sequence:CCGGGCCTTACAAAGTGATAAGAAACTCGAGTTTCTTATCACTTTGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011285.1-2059s1c1
Sequence:CCGGCCTTCTTTAATCGGATGTCATCTCGAGATGACATCCGATTAAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks