EMAIL THIS PAGE TO A FRIEND

RPL12

ribosomal protein L12

Synonyms: L12
UniProtKB ID: P30050, Q5VVV2, Q6PB27
Gene ID:
Human(6136) Summary: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L11P family of ribosomal proteins. It is located in the cytoplasm. The protein binds directly to the 26S rRNA. This gene is co-transcribed with the U65 snoRNA, which is located in its fourth intron. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Mouse(269261) ribosomal protein L12
Rat(499782) ribosomal protein L12
fruit fly(45329) Ribosomal protein L12
chicken(417264) ribosomal protein L12
domestic cat(101091568) ribosomal protein L12
dog(480716) ribosomal protein L12
Zebrafish(327089) ribosomal protein L12
cow(404133) ribosomal protein L12
sheep(101111087) ribosomal protein L12
naked mole-rat(101697243) ribosomal protein L12
domestic guinea pig(100727865) ribosomal protein L12
38 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0139 AQUA Peptide IGP[L]GL(pS)PK Drosophila melanogaster, African clawed frog, bakers yeast, chicken, cow, dog, honey bee, human, mouse, pig, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009076 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009076 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009076 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000976 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000976 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000976 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000976 Rosetta Predictions human pricing
NM_001109198 Rosetta Predictions rat pricing
NM_009076 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000976 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303625 predicted 333
2 SASI_Hs02_00303626 predicted 420
3 SASI_Hs02_00303627 predicted 494
4 SASI_Hs02_00303628 predicted 434
5 SASI_Hs02_00303629 predicted 491
6 SASI_Hs02_00303630 predicted 137
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109198 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246060 predicted 254
2 SASI_Rn02_00246061 predicted 257
3 SASI_Rn02_00246062 predicted 437
4 SASI_Rn02_00246063 predicted 239
5 SASI_Rn02_00246064 predicted 258
6 SASI_Rn02_00246065 predicted 284
7 SASI_Rn02_00246066 predicted 415
8 SASI_Rn02_00246067 predicted 315
9 SASI_Rn02_00246068 predicted 439
10 SASI_Rn02_00246069 predicted 333
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009076 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109022 predicted 336
2 SASI_Mm02_00315261 predicted 332
3 SASI_Mm02_00315262 predicted 197
4 SASI_Mm02_00315263 predicted 200
5 SASI_Mm02_00315264 predicted 191
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009076
RPL12 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein L12
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009076.1-315s1c1
Sequence:CCGGCCTGATCATCAAAGCCCTCAACTCGAGTTGAGGGCTTTGATGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009076.1-351s1c1
Sequence:CCGGCAGGAAGAAGCAGAAGAACATCTCGAGATGTTCTTCTGCTTCTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009076.1-443s1c1
Sequence:CCGGCTAGAGAACTTTCTGGAACTACTCGAGTAGTTCCAGAAAGTTCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009076.1-206s1c1
Sequence:CCGGGCGATGACATTGCCAAGGCTACTCGAGTAGCCTTGGCAATGTCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009076.1-369s1c1
Sequence:CCGGCATTAAACACAGTGGGAACATCTCGAGATGTTCCCACTGTGTTTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009076
RPL12 MISSION shRNA shRNA Plasmid DNA
ribosomal protein L12
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009076.1-315s1c1
Sequence:CCGGCCTGATCATCAAAGCCCTCAACTCGAGTTGAGGGCTTTGATGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009076.1-351s1c1
Sequence:CCGGCAGGAAGAAGCAGAAGAACATCTCGAGATGTTCTTCTGCTTCTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009076.1-443s1c1
Sequence:CCGGCTAGAGAACTTTCTGGAACTACTCGAGTAGTTCCAGAAAGTTCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009076.1-206s1c1
Sequence:CCGGGCGATGACATTGCCAAGGCTACTCGAGTAGCCTTGGCAATGTCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009076.1-369s1c1
Sequence:CCGGCATTAAACACAGTGGGAACATCTCGAGATGTTCCCACTGTGTTTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009076
RPL12 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein L12
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009076.1-315s1c1
Sequence:CCGGCCTGATCATCAAAGCCCTCAACTCGAGTTGAGGGCTTTGATGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009076.1-351s1c1
Sequence:CCGGCAGGAAGAAGCAGAAGAACATCTCGAGATGTTCTTCTGCTTCTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009076.1-443s1c1
Sequence:CCGGCTAGAGAACTTTCTGGAACTACTCGAGTAGTTCCAGAAAGTTCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009076.1-206s1c1
Sequence:CCGGGCGATGACATTGCCAAGGCTACTCGAGTAGCCTTGGCAATGTCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009076.1-369s1c1
Sequence:CCGGCATTAAACACAGTGGGAACATCTCGAGATGTTCCCACTGTGTTTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000976
VALIDATED
RPL12 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein L12
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000976.2-350s1c1
Sequence:CCGGCCACCAAGAGACAGAAAGAAACTCGAGTTTCTTTCTGTCTCTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000976.2-216s1c1
Sequence:CCGGGTGATGACATTGCCAAGGCAACTCGAGTTGCCTTGGCAATGTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000976.2-456s1c1
Sequence:CCGGGAGAACTCTCTGGAACCATTACTCGAGTAATGGTTCCAGAGAGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000976.2-253s1c1
Sequence:CCGGCCTGAGGATTACAGTGAAACTCTCGAGAGTTTCACTGTAATCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000976.2-379s1c1
Sequence:CCGGCATTAAACACAGTGGGAATATCTCGAGATATTCCCACTGTGTTTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000976.2-282s21c1
Sequence:CCGGAGAACAGACAGGCCCAGATTGCTCGAGCAATCTGGGCCTGTCTGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000976.2-566s21c1
Sequence:CCGGGTGGAATGCCCAGCCAGTTAACTCGAGTTAACTGGCTGGGCATTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000976.2-114s21c1
Sequence:CCGGAGATCAAAGTCGTATACCTGACTCGAGTCAGGTATACGACTTTGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000976.2-405s21c1
Sequence:CCGGTTGATGAGATTGTCAACATTGCTCGAGCAATGTTGACAATCTCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000976
VALIDATED
RPL12 MISSION shRNA shRNA Plasmid DNA
ribosomal protein L12
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000976.2-350s1c1
Sequence:CCGGCCACCAAGAGACAGAAAGAAACTCGAGTTTCTTTCTGTCTCTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000976.2-216s1c1
Sequence:CCGGGTGATGACATTGCCAAGGCAACTCGAGTTGCCTTGGCAATGTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000976.2-456s1c1
Sequence:CCGGGAGAACTCTCTGGAACCATTACTCGAGTAATGGTTCCAGAGAGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000976.2-253s1c1
Sequence:CCGGCCTGAGGATTACAGTGAAACTCTCGAGAGTTTCACTGTAATCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000976.2-379s1c1
Sequence:CCGGCATTAAACACAGTGGGAATATCTCGAGATATTCCCACTGTGTTTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000976.2-282s21c1
Sequence:CCGGAGAACAGACAGGCCCAGATTGCTCGAGCAATCTGGGCCTGTCTGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000976.2-566s21c1
Sequence:CCGGGTGGAATGCCCAGCCAGTTAACTCGAGTTAACTGGCTGGGCATTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000976.2-114s21c1
Sequence:CCGGAGATCAAAGTCGTATACCTGACTCGAGTCAGGTATACGACTTTGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000976.2-405s21c1
Sequence:CCGGTTGATGAGATTGTCAACATTGCTCGAGCAATGTTGACAATCTCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000976
VALIDATED
RPL12 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein L12
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000976.2-350s1c1
Sequence:CCGGCCACCAAGAGACAGAAAGAAACTCGAGTTTCTTTCTGTCTCTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000976.2-216s1c1
Sequence:CCGGGTGATGACATTGCCAAGGCAACTCGAGTTGCCTTGGCAATGTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000976.2-456s1c1
Sequence:CCGGGAGAACTCTCTGGAACCATTACTCGAGTAATGGTTCCAGAGAGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000976.2-253s1c1
Sequence:CCGGCCTGAGGATTACAGTGAAACTCTCGAGAGTTTCACTGTAATCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000976.2-379s1c1
Sequence:CCGGCATTAAACACAGTGGGAATATCTCGAGATATTCCCACTGTGTTTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000976.2-282s21c1
Sequence:CCGGAGAACAGACAGGCCCAGATTGCTCGAGCAATCTGGGCCTGTCTGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000976.2-566s21c1
Sequence:CCGGGTGGAATGCCCAGCCAGTTAACTCGAGTTAACTGGCTGGGCATTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000976.2-114s21c1
Sequence:CCGGAGATCAAAGTCGTATACCTGACTCGAGTCAGGTATACGACTTTGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000976.2-405s21c1
Sequence:CCGGTTGATGAGATTGTCAACATTGCTCGAGCAATGTTGACAATCTCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks