EMAIL THIS PAGE TO A FRIEND

RPL15

ribosomal protein L15

Synonyms: EC45 L15 RPL10 RPLY10 RPYL10
Gene ID:
Human(6138) Summary: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L15E family of ribosomal proteins. It is located in the cytoplasm. This gene shares sequence similarity with the yeast ribosomal protein YL10 gene. Although this gene has been referred to as RPL10, its official symbol is RPL15. This gene has been shown to be overexpressed in some esophageal tumors compared to normal matched tissues. Alternate splicing results in multiple transcript variants. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Nov 2011]
Mouse(66480) ribosomal protein L15
Rat(245981) ribosomal protein L15
fruit fly(3354918) Ribosomal protein L15
Thale Cress(822189) 50S ribosomal protein L15
chicken(428442) ribosomal protein L15
domestic cat(101083198) ribosomal protein L15
dog(477046) ribosomal protein L15
Zebrafish(445053) ribosomal protein L15
cow(507151) ribosomal protein L15
Goat(100861102) ribosomal protein L15
sheep(101103783) ribosomal protein L15
domestic guinea pig(100721678) ribosomal protein L15
naked mole-rat(101718044) ribosomal protein L15
105 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002948 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002948 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002948 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025586 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025586 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025586 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002948 Rosetta Predictions human pricing
NM_139114 Rosetta Predictions rat pricing
NM_025586 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002948 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023783 predicted 742
2 SASI_Hs01_00023784 predicted 699
3 SASI_Hs01_00023785 predicted 698
4 SASI_Hs01_00023786 predicted 698
5 SASI_Hs01_00023787 predicted 679
6 SASI_Hs01_00023788 predicted 737
7 SASI_Hs01_00023789 predicted 639
8 SASI_Hs01_00023791 predicted 613
9 SASI_Hs02_00334791 predicted 762
10 SASI_Hs02_00334792 predicted 710
11 SASI_Hs01_00023790 predicted 402
12 SASI_Hs01_00023792 predicted 255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139114 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096980 predicted 750
2 SASI_Rn01_00096981 predicted 959
3 SASI_Rn02_00268497 predicted 680
4 SASI_Rn01_00096982 predicted 952
5 SASI_Rn01_00096985 predicted 896
6 SASI_Rn02_00268498 predicted 721
7 SASI_Rn02_00268499 predicted 978
8 SASI_Rn02_00268500 predicted 898
9 SASI_Rn02_00268501 predicted 393
10 SASI_Rn02_00268502 predicted 236
11 SASI_Rn01_00096976 predicted 882
12 SASI_Rn01_00096977 predicted 916
13 SASI_Rn01_00096978 predicted 759
14 SASI_Rn01_00096979 predicted 806
15 SASI_Rn01_00096983 predicted 850
16 SASI_Rn01_00096984 predicted 892
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025586 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328571 predicted 767
2 SASI_Mm02_00328572 predicted 824
3 SASI_Mm02_00328573 predicted 943
4 SASI_Mm02_00328574 predicted 697
5 SASI_Mm02_00328575 predicted 886
6 SASI_Mm02_00328576 predicted 832
7 SASI_Mm02_00328577 predicted 944
8 SASI_Mm02_00328578 predicted 746
9 SASI_Mm02_00328579 predicted 701
10 SASI_Mm02_00328580 predicted 767
11 SASI_Mm01_00199521 predicted 577
12 SASI_Mm01_00199522 predicted 573
13 SASI_Mm01_00199523 predicted 572
14 SASI_Mm01_00199524 predicted 563
15 SASI_Mm01_00199525 predicted 801
16 SASI_Mm01_00199526 predicted 793
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002948
VALIDATED
RPL15 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein L15
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002948.2-256s21c1
Sequence:CCGGCCAGTTCCTAAGGGTGCAACTCTCGAGAGTTGCACCCTTAGGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002948.2-80s21c1
Sequence:CCGGAGTCTGATGTCATGCGCTTTCCTCGAGGAAAGCGCATGACATCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432090    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002948.2-704s21c1
Sequence:CCGGGTCTGCTTACAGGTGTTATTTCTCGAGAAATAACACCTGTAAGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422646    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002948.2-943s21c1
Sequence:CCGGTGAAACTAGCCCTGTAGATTTCTCGAGAAATCTACAGGGCTAGTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002948.2-486s21c1
Sequence:CCGGGATCACCAAACCAGTCCACAACTCGAGTTGTGGACTGGTTTGGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117692    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002948.2-1709s1c1
Sequence:CCGGCCAGGGTCAATTTGAGTGTAACTCGAGTTACACTCAAATTGACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002948.2-446s1c1
Sequence:CCGGCATTCCATAAAGCTATCAGAACTCGAGTTCTGATAGCTTTATGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002948.2-566s1c1
Sequence:CCGGGCCACAAGTTCCACCACACTACTCGAGTAGTGTGGTGGAACTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002948.2-200s1c1
Sequence:CCGGCCAAGCAAGGTTACGTTATATCTCGAGATATAACGTAACCTTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002948.2-568s1c1
Sequence:CCGGCACAAGTTCCACCACACTATTCTCGAGAATAGTGTGGTGGAACTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002948
VALIDATED
RPL15 MISSION shRNA shRNA Plasmid DNA
ribosomal protein L15
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002948.2-256s21c1
Sequence:CCGGCCAGTTCCTAAGGGTGCAACTCTCGAGAGTTGCACCCTTAGGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002948.2-80s21c1
Sequence:CCGGAGTCTGATGTCATGCGCTTTCCTCGAGGAAAGCGCATGACATCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432090    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002948.2-704s21c1
Sequence:CCGGGTCTGCTTACAGGTGTTATTTCTCGAGAAATAACACCTGTAAGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422646    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002948.2-943s21c1
Sequence:CCGGTGAAACTAGCCCTGTAGATTTCTCGAGAAATCTACAGGGCTAGTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002948.2-486s21c1
Sequence:CCGGGATCACCAAACCAGTCCACAACTCGAGTTGTGGACTGGTTTGGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117692    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002948.2-1709s1c1
Sequence:CCGGCCAGGGTCAATTTGAGTGTAACTCGAGTTACACTCAAATTGACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002948.2-446s1c1
Sequence:CCGGCATTCCATAAAGCTATCAGAACTCGAGTTCTGATAGCTTTATGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002948.2-566s1c1
Sequence:CCGGGCCACAAGTTCCACCACACTACTCGAGTAGTGTGGTGGAACTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002948.2-200s1c1
Sequence:CCGGCCAAGCAAGGTTACGTTATATCTCGAGATATAACGTAACCTTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002948.2-568s1c1
Sequence:CCGGCACAAGTTCCACCACACTATTCTCGAGAATAGTGTGGTGGAACTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002948
VALIDATED
RPL15 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein L15
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002948.2-256s21c1
Sequence:CCGGCCAGTTCCTAAGGGTGCAACTCTCGAGAGTTGCACCCTTAGGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002948.2-80s21c1
Sequence:CCGGAGTCTGATGTCATGCGCTTTCCTCGAGGAAAGCGCATGACATCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432090    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002948.2-704s21c1
Sequence:CCGGGTCTGCTTACAGGTGTTATTTCTCGAGAAATAACACCTGTAAGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422646    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002948.2-943s21c1
Sequence:CCGGTGAAACTAGCCCTGTAGATTTCTCGAGAAATCTACAGGGCTAGTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002948.2-486s21c1
Sequence:CCGGGATCACCAAACCAGTCCACAACTCGAGTTGTGGACTGGTTTGGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117692    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002948.2-1709s1c1
Sequence:CCGGCCAGGGTCAATTTGAGTGTAACTCGAGTTACACTCAAATTGACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002948.2-446s1c1
Sequence:CCGGCATTCCATAAAGCTATCAGAACTCGAGTTCTGATAGCTTTATGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002948.2-566s1c1
Sequence:CCGGGCCACAAGTTCCACCACACTACTCGAGTAGTGTGGTGGAACTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002948.2-200s1c1
Sequence:CCGGCCAAGCAAGGTTACGTTATATCTCGAGATATAACGTAACCTTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002948.2-568s1c1
Sequence:CCGGCACAAGTTCCACCACACTATTCTCGAGAATAGTGTGGTGGAACTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025586
VALIDATED
RPL15 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein L15
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025586.1-449s1c1
Sequence:CCGGCGTTCCATAAAGCTATCAGAACTCGAGTTCTGATAGCTTTATGGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025586.1-202s1c1
Sequence:CCGGGCTAAGCAAGGCTATGTCATTCTCGAGAATGACATAGCCTTGCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025586.1-392s1c1
Sequence:CCGGCCTACTGGGTTGGTGAAGATTCTCGAGAATCTTCACCAACCCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025586.1-499s1c1
Sequence:CCGGCCAGTCCACAAACACAGAGAACTCGAGTTCTCTGTGTTTGTGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025586.1-297s1c1
Sequence:CCGGCCATGGTGTTAACCAGCTGAACTCGAGTTCAGCTGGTTAACACCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025586
VALIDATED
RPL15 MISSION shRNA shRNA Plasmid DNA
ribosomal protein L15
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025586.1-449s1c1
Sequence:CCGGCGTTCCATAAAGCTATCAGAACTCGAGTTCTGATAGCTTTATGGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025586.1-202s1c1
Sequence:CCGGGCTAAGCAAGGCTATGTCATTCTCGAGAATGACATAGCCTTGCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025586.1-392s1c1
Sequence:CCGGCCTACTGGGTTGGTGAAGATTCTCGAGAATCTTCACCAACCCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025586.1-499s1c1
Sequence:CCGGCCAGTCCACAAACACAGAGAACTCGAGTTCTCTGTGTTTGTGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025586.1-297s1c1
Sequence:CCGGCCATGGTGTTAACCAGCTGAACTCGAGTTCAGCTGGTTAACACCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025586
VALIDATED
RPL15 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein L15
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025586.1-449s1c1
Sequence:CCGGCGTTCCATAAAGCTATCAGAACTCGAGTTCTGATAGCTTTATGGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025586.1-202s1c1
Sequence:CCGGGCTAAGCAAGGCTATGTCATTCTCGAGAATGACATAGCCTTGCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025586.1-392s1c1
Sequence:CCGGCCTACTGGGTTGGTGAAGATTCTCGAGAATCTTCACCAACCCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025586.1-499s1c1
Sequence:CCGGCCAGTCCACAAACACAGAGAACTCGAGTTCTCTGTGTTTGTGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025586.1-297s1c1
Sequence:CCGGCCATGGTGTTAACCAGCTGAACTCGAGTTCAGCTGGTTAACACCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks