EMAIL THIS PAGE TO A FRIEND

RPL17P6

ribosomal protein L17 pseudogene 6

Synonyms: RPL17_1_64
Species: Human RPL17P6(645441)
Gene ID:
1 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001093734 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001093734 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001093734 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001093734 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001093734 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318150 predicted 1043
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001093734
RPL17P6 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein L17 pseudogene 6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093734.1-1144s21c1
Sequence:CCGGCAGAGCTCATGGTCGGATTAACTCGAGTTAATCCGACCATGAGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093734.1-927s21c1
Sequence:CCGGTACCATTCCGACGTTACAATGCTCGAGCATTGTAACGTCGGAATGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093734.1-1098s21c1
Sequence:CCGGAGCATATCCAAGTGAACAAAGCTCGAGCTTTGTTCACTTGGATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093734.1-829s21c1
Sequence:CCGGCTTTAAGAACACTCGTGAAACCTCGAGGTTTCACGAGTGTTCTTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093734.1-1049s21c1
Sequence:CCGGGAGAGTAATGCTGAACTTAAGCTCGAGCTTAAGTTCAGCATTACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001093734
RPL17P6 MISSION shRNA shRNA Plasmid DNA
ribosomal protein L17 pseudogene 6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093734.1-1144s21c1
Sequence:CCGGCAGAGCTCATGGTCGGATTAACTCGAGTTAATCCGACCATGAGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093734.1-927s21c1
Sequence:CCGGTACCATTCCGACGTTACAATGCTCGAGCATTGTAACGTCGGAATGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093734.1-1098s21c1
Sequence:CCGGAGCATATCCAAGTGAACAAAGCTCGAGCTTTGTTCACTTGGATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093734.1-829s21c1
Sequence:CCGGCTTTAAGAACACTCGTGAAACCTCGAGGTTTCACGAGTGTTCTTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093734.1-1049s21c1
Sequence:CCGGGAGAGTAATGCTGAACTTAAGCTCGAGCTTAAGTTCAGCATTACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001093734
RPL17P6 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein L17 pseudogene 6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093734.1-1144s21c1
Sequence:CCGGCAGAGCTCATGGTCGGATTAACTCGAGTTAATCCGACCATGAGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093734.1-927s21c1
Sequence:CCGGTACCATTCCGACGTTACAATGCTCGAGCATTGTAACGTCGGAATGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093734.1-1098s21c1
Sequence:CCGGAGCATATCCAAGTGAACAAAGCTCGAGCTTTGTTCACTTGGATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093734.1-829s21c1
Sequence:CCGGCTTTAAGAACACTCGTGAAACCTCGAGGTTTCACGAGTGTTCTTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093734.1-1049s21c1
Sequence:CCGGGAGAGTAATGCTGAACTTAAGCTCGAGCTTAAGTTCAGCATTACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks