EMAIL THIS PAGE TO A FRIEND

RPL18

ribosomal protein L18

Synonyms: L18
UniProtKB ID: Q07020, Q8WTZ6
Gene ID:
Human(6141) Summary: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a member of the L18E family of ribosomal proteins that is a component of the 60S subunit. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Mouse(19899) ribosomal protein L18
Rat(81766) ribosomal protein L18
fruit fly(38794) Ribosomal protein L18
Horse(100051091) ribosomal protein L18
domestic cat(751614) ribosomal protein L18
dog(480848) ribosomal protein L18 pseudogene
dog(476422) ribosomal protein L18
Zebrafish(445038) ribosomal protein L18
Thale Cress(819725) 60S ribosomal protein L18-2
domestic guinea pig(100732461) ribosomal protein L18
Domestic Rabbit(100008964) ribosomal protein L18
naked mole-rat(101720539) ribosomal protein L18
cow(509163) ribosomal protein L18
sheep(101122808) ribosomal protein L18
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000979 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000979 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000979 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009077 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009077 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009077 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000979 Rosetta Predictions human pricing
NM_031102 Rosetta Predictions rat pricing
NM_009077 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000979 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141379 predicted 351
2 SASI_Hs01_00141382 predicted 322
3 SASI_Hs01_00141378 predicted 283
4 SASI_Hs01_00141383 predicted 223
5 SASI_Hs01_00141384 predicted 219
6 SASI_Hs01_00141381 predicted 292
7 SASI_Hs01_00141385 predicted 111
8 SASI_Hs01_00141387 predicted 35
9 SASI_Hs02_00303638 predicted 598
10 SASI_Hs01_00141386 predicted 49
11 SASI_Hs01_00141380 predicted 356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031102 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264373 predicted 201
2 SASI_Rn02_00264374 predicted 204
3 SASI_Rn02_00264375 predicted 204
4 SASI_Rn02_00264376 predicted 198
5 SASI_Rn01_00063390 predicted 220
6 SASI_Rn01_00063391 predicted 335
7 SASI_Rn01_00063392 predicted 277
8 SASI_Rn01_00063393 predicted 321
9 SASI_Rn01_00063394 predicted 335
10 SASI_Rn02_00264377 predicted 205
11 SASI_Rn01_00063395 predicted 264
12 SASI_Rn01_00063396 predicted 329
13 SASI_Rn01_00063397 predicted 265
14 SASI_Rn01_00063398 predicted 217
15 SASI_Rn01_00063399 predicted 300
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009077 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176399 predicted 377
2 SASI_Mm01_00176400 predicted 381
3 SASI_Mm01_00176401 predicted 490
4 SASI_Mm01_00176405 predicted 564
5 SASI_Mm01_00176402 predicted 564
6 SASI_Mm01_00176403 predicted 497
7 SASI_Mm01_00176404 predicted 577
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000979
VALIDATED
RPL18 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein L18
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000979.2-170s21c1
Sequence:CCGGTTGTGTTGAAGAGGTTGTTTACTCGAGTAAACAACCTCTTCAACACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000979.2-106s21c1
Sequence:CCGGCTGAGGCTGTTGGTCAAGTTACTCGAGTAACTTGACCAACAGCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000979.2-468s21c1
Sequence:CCGGCCGAGAGGTGTACCGGCATTTCTCGAGAAATGCCGGTACACCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000979.2-142s21c1
Sequence:CCGGAGAAGAACCAACTCCACATTCCTCGAGGAATGTGGAGTTGGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000979.2-316s21c1
Sequence:CCGGGTACCCAAACTGAAGGTATGTCTCGAGACATACCTTCAGTTTGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000979.2-106s1c1
Sequence:CCGGCTGAGGCTGTTGGTCAAGTTACTCGAGTAACTTGACCAACAGCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000979.2-468s1c1
Sequence:CCGGCCGAGAGGTGTACCGGCATTTCTCGAGAAATGCCGGTACACCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000979.2-289s1c1
Sequence:CCGGATAACTGATGATGTGCGGGTTCTCGAGAACCCGCACATCATCAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000979.2-114s1c1
Sequence:CCGGGTTGGTCAAGTTATACAGGTTCTCGAGAACCTGTATAACTTGACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000979.2-108s1c1
Sequence:CCGGGAGGCTGTTGGTCAAGTTATACTCGAGTATAACTTGACCAACAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000979
VALIDATED
RPL18 MISSION shRNA shRNA Plasmid DNA
ribosomal protein L18
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000979.2-170s21c1
Sequence:CCGGTTGTGTTGAAGAGGTTGTTTACTCGAGTAAACAACCTCTTCAACACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000979.2-106s21c1
Sequence:CCGGCTGAGGCTGTTGGTCAAGTTACTCGAGTAACTTGACCAACAGCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000979.2-468s21c1
Sequence:CCGGCCGAGAGGTGTACCGGCATTTCTCGAGAAATGCCGGTACACCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000979.2-142s21c1
Sequence:CCGGAGAAGAACCAACTCCACATTCCTCGAGGAATGTGGAGTTGGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000979.2-316s21c1
Sequence:CCGGGTACCCAAACTGAAGGTATGTCTCGAGACATACCTTCAGTTTGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000979.2-106s1c1
Sequence:CCGGCTGAGGCTGTTGGTCAAGTTACTCGAGTAACTTGACCAACAGCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000979.2-468s1c1
Sequence:CCGGCCGAGAGGTGTACCGGCATTTCTCGAGAAATGCCGGTACACCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000979.2-289s1c1
Sequence:CCGGATAACTGATGATGTGCGGGTTCTCGAGAACCCGCACATCATCAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000979.2-114s1c1
Sequence:CCGGGTTGGTCAAGTTATACAGGTTCTCGAGAACCTGTATAACTTGACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000979.2-108s1c1
Sequence:CCGGGAGGCTGTTGGTCAAGTTATACTCGAGTATAACTTGACCAACAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000979
VALIDATED
RPL18 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein L18
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000979.2-170s21c1
Sequence:CCGGTTGTGTTGAAGAGGTTGTTTACTCGAGTAAACAACCTCTTCAACACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000979.2-106s21c1
Sequence:CCGGCTGAGGCTGTTGGTCAAGTTACTCGAGTAACTTGACCAACAGCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000979.2-468s21c1
Sequence:CCGGCCGAGAGGTGTACCGGCATTTCTCGAGAAATGCCGGTACACCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000979.2-142s21c1
Sequence:CCGGAGAAGAACCAACTCCACATTCCTCGAGGAATGTGGAGTTGGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000979.2-316s21c1
Sequence:CCGGGTACCCAAACTGAAGGTATGTCTCGAGACATACCTTCAGTTTGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000979.2-106s1c1
Sequence:CCGGCTGAGGCTGTTGGTCAAGTTACTCGAGTAACTTGACCAACAGCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000979.2-468s1c1
Sequence:CCGGCCGAGAGGTGTACCGGCATTTCTCGAGAAATGCCGGTACACCTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000979.2-289s1c1
Sequence:CCGGATAACTGATGATGTGCGGGTTCTCGAGAACCCGCACATCATCAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000979.2-114s1c1
Sequence:CCGGGTTGGTCAAGTTATACAGGTTCTCGAGAACCTGTATAACTTGACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000979.2-108s1c1
Sequence:CCGGGAGGCTGTTGGTCAAGTTATACTCGAGTATAACTTGACCAACAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009077
VALIDATED
RPL18 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein L18
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009077.2-204s21c1
Sequence:CCGGTGTGCTGAAGAGGTTGTTCATCTCGAGATGAACAACCTCTTCAGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009077.2-258s21c1
Sequence:CCGGCCGCATGATCCGAAAGATGAACTCGAGTTCATCTTTCGGATCATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009077.2-322s21c1
Sequence:CCGGGTCACAGATGATGTGCGGATTCTCGAGAATCCGCACATCATCTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009077.2-178s21c1
Sequence:CCGGCGGACCAACTCCACCTTCAATCTCGAGATTGAAGGTGGAGTTGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009077.1-461s1c1
Sequence:CCGGGCGAGATGTGTTCCCACATTTCTCGAGAAATGTGGGAACACATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009077.1-218s1c1
Sequence:CCGGCCGCATGATCCGAAAGATGAACTCGAGTTCATCTTTCGGATCATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009077.1-138s1c1
Sequence:CCGGCGGACCAACTCCACCTTCAATCTCGAGATTGAAGGTGGAGTTGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009077.1-164s1c1
Sequence:CCGGTGTGCTGAAGAGGTTGTTCATCTCGAGATGAACAACCTCTTCAGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009077.1-282s1c1
Sequence:CCGGGTCACAGATGATGTGCGGATTCTCGAGAATCCGCACATCATCTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009077
VALIDATED
RPL18 MISSION shRNA shRNA Plasmid DNA
ribosomal protein L18
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009077.2-204s21c1
Sequence:CCGGTGTGCTGAAGAGGTTGTTCATCTCGAGATGAACAACCTCTTCAGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009077.2-258s21c1
Sequence:CCGGCCGCATGATCCGAAAGATGAACTCGAGTTCATCTTTCGGATCATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009077.2-322s21c1
Sequence:CCGGGTCACAGATGATGTGCGGATTCTCGAGAATCCGCACATCATCTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009077.2-178s21c1
Sequence:CCGGCGGACCAACTCCACCTTCAATCTCGAGATTGAAGGTGGAGTTGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009077.1-461s1c1
Sequence:CCGGGCGAGATGTGTTCCCACATTTCTCGAGAAATGTGGGAACACATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009077.1-218s1c1
Sequence:CCGGCCGCATGATCCGAAAGATGAACTCGAGTTCATCTTTCGGATCATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009077.1-138s1c1
Sequence:CCGGCGGACCAACTCCACCTTCAATCTCGAGATTGAAGGTGGAGTTGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009077.1-164s1c1
Sequence:CCGGTGTGCTGAAGAGGTTGTTCATCTCGAGATGAACAACCTCTTCAGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009077.1-282s1c1
Sequence:CCGGGTCACAGATGATGTGCGGATTCTCGAGAATCCGCACATCATCTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009077
VALIDATED
RPL18 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein L18
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000318245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009077.2-204s21c1
Sequence:CCGGTGTGCTGAAGAGGTTGTTCATCTCGAGATGAACAACCTCTTCAGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009077.2-258s21c1
Sequence:CCGGCCGCATGATCCGAAAGATGAACTCGAGTTCATCTTTCGGATCATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009077.2-322s21c1
Sequence:CCGGGTCACAGATGATGTGCGGATTCTCGAGAATCCGCACATCATCTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009077.2-178s21c1
Sequence:CCGGCGGACCAACTCCACCTTCAATCTCGAGATTGAAGGTGGAGTTGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009077.1-461s1c1
Sequence:CCGGGCGAGATGTGTTCCCACATTTCTCGAGAAATGTGGGAACACATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009077.1-218s1c1
Sequence:CCGGCCGCATGATCCGAAAGATGAACTCGAGTTCATCTTTCGGATCATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009077.1-138s1c1
Sequence:CCGGCGGACCAACTCCACCTTCAATCTCGAGATTGAAGGTGGAGTTGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009077.1-164s1c1
Sequence:CCGGTGTGCTGAAGAGGTTGTTCATCTCGAGATGAACAACCTCTTCAGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009077.1-282s1c1
Sequence:CCGGGTCACAGATGATGTGCGGATTCTCGAGAATCCGCACATCATCTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks