EMAIL THIS PAGE TO A FRIEND

RPL19

ribosomal protein L19

Synonyms: L19
UniProtKB ID: P84098, B2R4K2, P14118, P22908, Q502Y6, Q7Z6E4
Gene ID:
Human(6143) Summary: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L19E family of ribosomal proteins. It is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Mouse(19921) ribosomal protein L19
Rat(81767) ribosomal protein L19
fruit fly(37995) Ribosomal protein L19
Zebrafish(406489) ribosomal protein L19
Horse(100034006) ribosomal protein L19
domestic cat(101100605) ribosomal protein L19
dog(403682) ribosomal protein L19
chicken(420003) ribosomal protein L19
cow(510615) ribosomal protein L19
sheep(100270789) ribosomal protein L19
cow(100336099) ribosomal protein L19
domestic guinea pig(100721787) ribosomal protein L19
naked mole-rat(101714236) ribosomal protein L19
38 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000981 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000981 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000981 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009078 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009078 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009078 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000981 Rosetta Predictions human pricing
NM_031103 Rosetta Predictions rat pricing
NM_009078 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000981 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091665 predicted 280
2 SASI_Hs01_00091666 predicted 58
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031103 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264378 predicted 207
2 SASI_Rn02_00264379 predicted 23
3 SASI_Rn01_00102626 predicted 641
4 SASI_Rn01_00102627 predicted 126
5 SASI_Rn02_00264380 predicted 138
6 SASI_Rn01_00102628 predicted 125
7 SASI_Rn01_00102630 predicted 642
8 SASI_Rn02_00264381 predicted 53
9 SASI_Rn01_00102629 predicted 608
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009078 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315265 predicted 317
2 SASI_Mm02_00315266 predicted 314
3 SASI_Mm02_00315267 predicted 448
4 SASI_Mm02_00315268 predicted 333
5 SASI_Mm02_00315269 predicted 434
6 SASI_Mm02_00315270 predicted 357
7 SASI_Mm02_00315271 predicted 206
8 SASI_Mm02_00315272 predicted 409
9 SASI_Mm01_00109790 predicted 330
10 SASI_Mm02_00315273 predicted 438
11 SASI_Mm01_00109791 predicted 296
12 SASI_Mm01_00109792 predicted 332
13 SASI_Mm01_00109793 predicted 298
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000981
VALIDATED
RPL19 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein L19
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000981.3-467s21c1
Sequence:CCGGGCGGATTCTCATGGAACACATCTCGAGATGTGTTCCATGAGAATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000981.3-593s21c1
Sequence:CCGGCCAGGCCAAGAAGGAGGAGATCTCGAGATCTCCTCCTTCTTGGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000981.3-413s21c1
Sequence:CCGGCCACATGTATCACAGCCTGTACTCGAGTACAGGCTGTGATACATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000981.3-390s21c1
Sequence:CCGGCGTGAATCTAAGAAGATCGATCTCGAGATCGATCTTCTTAGATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000981.3-467s1c1
Sequence:CCGGGCGGATTCTCATGGAACACATCTCGAGATGTGTTCCATGAGAATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000981.3-413s1c1
Sequence:CCGGCCACATGTATCACAGCCTGTACTCGAGTACAGGCTGTGATACATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000981.3-593s1c1
Sequence:CCGGCCAGGCCAAGAAGGAGGAGATCTCGAGATCTCCTCCTTCTTGGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000981.3-390s1c1
Sequence:CCGGCGTGAATCTAAGAAGATCGATCTCGAGATCGATCTTCTTAGATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000981.3-191s1c1
Sequence:CCGGGCTCATCAAAGATGGGCTGATCTCGAGATCAGCCCATCTTTGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000981
VALIDATED
RPL19 MISSION shRNA shRNA Plasmid DNA
ribosomal protein L19
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000981.3-467s21c1
Sequence:CCGGGCGGATTCTCATGGAACACATCTCGAGATGTGTTCCATGAGAATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000981.3-593s21c1
Sequence:CCGGCCAGGCCAAGAAGGAGGAGATCTCGAGATCTCCTCCTTCTTGGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000981.3-413s21c1
Sequence:CCGGCCACATGTATCACAGCCTGTACTCGAGTACAGGCTGTGATACATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000981.3-390s21c1
Sequence:CCGGCGTGAATCTAAGAAGATCGATCTCGAGATCGATCTTCTTAGATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000981.3-467s1c1
Sequence:CCGGGCGGATTCTCATGGAACACATCTCGAGATGTGTTCCATGAGAATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000981.3-413s1c1
Sequence:CCGGCCACATGTATCACAGCCTGTACTCGAGTACAGGCTGTGATACATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000981.3-593s1c1
Sequence:CCGGCCAGGCCAAGAAGGAGGAGATCTCGAGATCTCCTCCTTCTTGGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000981.3-390s1c1
Sequence:CCGGCGTGAATCTAAGAAGATCGATCTCGAGATCGATCTTCTTAGATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000981.3-191s1c1
Sequence:CCGGGCTCATCAAAGATGGGCTGATCTCGAGATCAGCCCATCTTTGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000981
VALIDATED
RPL19 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein L19
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000981.3-467s21c1
Sequence:CCGGGCGGATTCTCATGGAACACATCTCGAGATGTGTTCCATGAGAATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000981.3-593s21c1
Sequence:CCGGCCAGGCCAAGAAGGAGGAGATCTCGAGATCTCCTCCTTCTTGGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000981.3-413s21c1
Sequence:CCGGCCACATGTATCACAGCCTGTACTCGAGTACAGGCTGTGATACATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000981.3-390s21c1
Sequence:CCGGCGTGAATCTAAGAAGATCGATCTCGAGATCGATCTTCTTAGATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000981.3-467s1c1
Sequence:CCGGGCGGATTCTCATGGAACACATCTCGAGATGTGTTCCATGAGAATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000981.3-413s1c1
Sequence:CCGGCCACATGTATCACAGCCTGTACTCGAGTACAGGCTGTGATACATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000981.3-593s1c1
Sequence:CCGGCCAGGCCAAGAAGGAGGAGATCTCGAGATCTCCTCCTTCTTGGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000981.3-390s1c1
Sequence:CCGGCGTGAATCTAAGAAGATCGATCTCGAGATCGATCTTCTTAGATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000981.3-191s1c1
Sequence:CCGGGCTCATCAAAGATGGGCTGATCTCGAGATCAGCCCATCTTTGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009078
VALIDATED
RPL19 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein L19
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009078.1-484s1c1
Sequence:CCGGCGCAGGTCTAAGACCAAGGAACTCGAGTTCCTTGGTCTTAGACCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009078.1-73s1c1
Sequence:CCGGGATCCCAATGAGACCAATGAACTCGAGTTCATTGGTCTCATTGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009078.1-335s1c1
Sequence:CCGGCCAAGAAGATTGACCGCCATACTCGAGTATGGCGGTCAATCTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009078.1-82s1c1
Sequence:CCGGGAGACCAATGAAATCGCCAATCTCGAGATTGGCGATTTCATTGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009078.1-351s1c1
Sequence:CCGGCCATATGTATCACAGCCTGTACTCGAGTACAGGCTGTGATACATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009078
VALIDATED
RPL19 MISSION shRNA shRNA Plasmid DNA
ribosomal protein L19
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009078.1-484s1c1
Sequence:CCGGCGCAGGTCTAAGACCAAGGAACTCGAGTTCCTTGGTCTTAGACCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009078.1-73s1c1
Sequence:CCGGGATCCCAATGAGACCAATGAACTCGAGTTCATTGGTCTCATTGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009078.1-335s1c1
Sequence:CCGGCCAAGAAGATTGACCGCCATACTCGAGTATGGCGGTCAATCTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009078.1-82s1c1
Sequence:CCGGGAGACCAATGAAATCGCCAATCTCGAGATTGGCGATTTCATTGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009078.1-351s1c1
Sequence:CCGGCCATATGTATCACAGCCTGTACTCGAGTACAGGCTGTGATACATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009078
VALIDATED
RPL19 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein L19
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009078.1-484s1c1
Sequence:CCGGCGCAGGTCTAAGACCAAGGAACTCGAGTTCCTTGGTCTTAGACCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009078.1-73s1c1
Sequence:CCGGGATCCCAATGAGACCAATGAACTCGAGTTCATTGGTCTCATTGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009078.1-335s1c1
Sequence:CCGGCCAAGAAGATTGACCGCCATACTCGAGTATGGCGGTCAATCTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009078.1-82s1c1
Sequence:CCGGGAGACCAATGAAATCGCCAATCTCGAGATTGGCGATTTCATTGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009078.1-351s1c1
Sequence:CCGGCCATATGTATCACAGCCTGTACTCGAGTACAGGCTGTGATACATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks