EMAIL THIS PAGE TO A FRIEND

RPL26P11

ribosomal protein L26 pseudogene 11

Synonyms: RPL26_5_125
Species: Human RPL26P11(730070)
Gene ID:
10 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_001132289 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001132289 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001132289 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001132289 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001132289 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00389257 predicted 50
2 SASI_Hs02_00389258 predicted 106
3 SASI_Hs02_00389259 predicted 114
4 SASI_Hs02_00389260 predicted 144
5 SASI_Hs02_00389261 predicted 133
6 SASI_Hs02_00389262 predicted 77
7 SASI_Hs02_00389263 predicted 11
8 SASI_Hs02_00389264 predicted 71
9 SASI_Hs02_00389265 predicted 79
10 SASI_Hs02_00389266 predicted 38
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001132289
RPL26P11 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein L26 pseudogene 11
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001132289.1-45s21c1
Sequence:CCGGGAGTGCACTAAATGCCCATATCTCGAGATATGGGCATTTAGTGCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001132289.1-73s21c1
Sequence:CCGGCAATCCATGCCTAACCGAAAGCTCGAGCTTTCGGTTAGGCATGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001132289.1-177s21c1
Sequence:CCGGATATGTCATCTACATTGAATGCTCGAGCATTCAATGTAGATGACATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001132289.1-115s21c1
Sequence:CCGGCGAGTACGAGGACACTATAAACTCGAGTTTATAGTGTCCTCGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001132289.1-149s21c1
Sequence:CCGGGTACAGTAGTCCAGGTTTACACTCGAGTGTAAACCTGGACTACTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001132289
RPL26P11 MISSION shRNA shRNA Plasmid DNA
ribosomal protein L26 pseudogene 11
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001132289.1-45s21c1
Sequence:CCGGGAGTGCACTAAATGCCCATATCTCGAGATATGGGCATTTAGTGCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001132289.1-73s21c1
Sequence:CCGGCAATCCATGCCTAACCGAAAGCTCGAGCTTTCGGTTAGGCATGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001132289.1-177s21c1
Sequence:CCGGATATGTCATCTACATTGAATGCTCGAGCATTCAATGTAGATGACATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001132289.1-115s21c1
Sequence:CCGGCGAGTACGAGGACACTATAAACTCGAGTTTATAGTGTCCTCGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001132289.1-149s21c1
Sequence:CCGGGTACAGTAGTCCAGGTTTACACTCGAGTGTAAACCTGGACTACTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001132289
RPL26P11 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein L26 pseudogene 11
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001132289.1-45s21c1
Sequence:CCGGGAGTGCACTAAATGCCCATATCTCGAGATATGGGCATTTAGTGCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001132289.1-73s21c1
Sequence:CCGGCAATCCATGCCTAACCGAAAGCTCGAGCTTTCGGTTAGGCATGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001132289.1-177s21c1
Sequence:CCGGATATGTCATCTACATTGAATGCTCGAGCATTCAATGTAGATGACATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001132289.1-115s21c1
Sequence:CCGGCGAGTACGAGGACACTATAAACTCGAGTTTATAGTGTCCTCGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001132289.1-149s21c1
Sequence:CCGGGTACAGTAGTCCAGGTTTACACTCGAGTGTAAACCTGGACTACTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks