EMAIL THIS PAGE TO A FRIEND

RPL31

ribosomal protein L31

Synonyms: L31
Gene ID:
Human(6160) Summary: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L31E family of ribosomal proteins. It is located in the cytoplasm. Higher levels of expression of this gene in familial adenomatous polyps compared to matched normal tissues have been observed. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(114641) ribosomal protein L31
Rat(64298) ribosomal protein L31
fruit fly(35988) Ribosomal protein L31
domestic cat(101082228) ribosomal protein L31
dog(609530) ribosomal protein L31
Zebrafish(677758) ribosomal protein L31
chicken(418710) ribosomal protein L31
domestic guinea pig(100729458) ribosomal protein L31
naked mole-rat(101704888) ribosomal protein L31
cow(534279) ribosomal protein L31
sheep(101104219) ribosomal protein L31
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053257 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053257 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053257 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000993 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000993 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000993 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU127811 MISSION® esiRNA esiRNA human RPL31 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000993 Rosetta Predictions human pricing
NM_001098577 Rosetta Predictions human pricing
NM_001099693 Rosetta Predictions human pricing
NM_022506 Rosetta Predictions rat pricing
NM_053257 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000993 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303681 predicted 97
2 SASI_Hs01_00064019 predicted 463
3 SASI_Hs01_00064020 predicted 378
4 SASI_Hs01_00064021 predicted 88
5 SASI_Hs01_00064018 predicted 207
6 SASI_Hs01_00064022 predicted 336
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098577 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319446 predicted 755
2 SASI_Hs02_00319447 predicted 666
3 SASI_Hs02_00319448 predicted 715
4 SASI_Hs02_00319449 predicted 671
5 SASI_Hs02_00319450 predicted 773
6 SASI_Hs02_00319451 predicted 823
7 SASI_Hs02_00319452 predicted 722
8 SASI_Hs02_00319453 predicted 540
9 SASI_Hs02_00319454 predicted 573
10 SASI_Hs02_00319455 predicted 808
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099693 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321135 predicted 439
2 SASI_Hs02_00321136 predicted 496
3 SASI_Hs02_00321137 predicted 369
4 SASI_Hs02_00321138 predicted 374
5 SASI_Hs02_00321139 predicted 448
6 SASI_Hs02_00321140 predicted 437
7 SASI_Hs02_00321141 predicted 445
8 SASI_Hs02_00321142 predicted 433
9 SASI_Hs02_00321143 predicted 312
10 SASI_Hs02_00321144 predicted 135
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022506 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263227 predicted 210
2 SASI_Rn02_00263228 predicted 208
3 SASI_Rn02_00263229 predicted 191
4 SASI_Rn02_00263230 predicted 206
5 SASI_Rn02_00263231 predicted 202
6 SASI_Rn02_00263232 predicted 212
7 SASI_Rn02_00263233 predicted 209
8 SASI_Rn02_00263234 predicted 76
9 SASI_Rn02_00263235 predicted 274
10 SASI_Rn02_00263236 predicted 252
11 SASI_Rn01_00093390 predicted 682
12 SASI_Rn01_00093391 predicted 693
13 SASI_Rn01_00093392 predicted 693
14 SASI_Rn01_00093393 predicted 728
15 SASI_Rn01_00093394 predicted 561
16 SASI_Rn01_00093395 predicted 696
17 SASI_Rn01_00093396 predicted 781
18 SASI_Rn01_00093397 predicted 571
19 SASI_Rn01_00093398 predicted 834
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053257 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160118 predicted 691
2 SASI_Mm01_00160119 predicted 701
3 SASI_Mm02_00337883 predicted 679
4 SASI_Mm01_00160120 predicted 520
5 SASI_Mm01_00160121 predicted 510
6 SASI_Mm01_00160122 predicted 480
7 SASI_Mm01_00160123 predicted 506
8 SASI_Mm01_00160124 predicted 559
9 SASI_Mm02_00337884 predicted 602
10 SASI_Mm01_00160126 predicted 483
11 SASI_Mm01_00160125 predicted 754
12 SASI_Mm01_00160127 predicted 752
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053257
VALIDATED
RPL31 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein L31
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053257.1-165s1c1
Sequence:CCGGCGGAAGTTTGCCATGAAGGAACTCGAGTTCCTTCATGGCAAACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053257.1-341s1c1
Sequence:CCGGCGTGCCTGTTACCACATTCAACTCGAGTTGAATGTGGTAACAGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053257.1-679s1c1
Sequence:CCGGCCTCCCTAGTATTGGCAATTACTCGAGTAATTGCCAATACTAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053257.1-144s1c1
Sequence:CCGGCCTCGGGCACTCAAAGAAATTCTCGAGAATTTCTTTGAGTGCCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053257.1-237s1c1
Sequence:CCGGGCCAAGGGAATAAGGAACGTTCTCGAGAACGTTCCTTATTCCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053257.3-547s21c1
Sequence:CCGGGGTCTACAGGGTGTTGGAAATCTCGAGATTTCCAACACCCTGTAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435899    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053257.3-599s21c1
Sequence:CCGGGAAATTAGAAATACGTGAAACCTCGAGGTTTCACGTATTTCTAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053257
VALIDATED
RPL31 MISSION shRNA shRNA Plasmid DNA
ribosomal protein L31
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053257.1-165s1c1
Sequence:CCGGCGGAAGTTTGCCATGAAGGAACTCGAGTTCCTTCATGGCAAACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053257.1-341s1c1
Sequence:CCGGCGTGCCTGTTACCACATTCAACTCGAGTTGAATGTGGTAACAGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053257.1-679s1c1
Sequence:CCGGCCTCCCTAGTATTGGCAATTACTCGAGTAATTGCCAATACTAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053257.1-144s1c1
Sequence:CCGGCCTCGGGCACTCAAAGAAATTCTCGAGAATTTCTTTGAGTGCCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053257.1-237s1c1
Sequence:CCGGGCCAAGGGAATAAGGAACGTTCTCGAGAACGTTCCTTATTCCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053257.3-547s21c1
Sequence:CCGGGGTCTACAGGGTGTTGGAAATCTCGAGATTTCCAACACCCTGTAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435899    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053257.3-599s21c1
Sequence:CCGGGAAATTAGAAATACGTGAAACCTCGAGGTTTCACGTATTTCTAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053257
VALIDATED
RPL31 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein L31
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053257.1-165s1c1
Sequence:CCGGCGGAAGTTTGCCATGAAGGAACTCGAGTTCCTTCATGGCAAACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053257.1-341s1c1
Sequence:CCGGCGTGCCTGTTACCACATTCAACTCGAGTTGAATGTGGTAACAGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053257.1-679s1c1
Sequence:CCGGCCTCCCTAGTATTGGCAATTACTCGAGTAATTGCCAATACTAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053257.1-144s1c1
Sequence:CCGGCCTCGGGCACTCAAAGAAATTCTCGAGAATTTCTTTGAGTGCCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053257.1-237s1c1
Sequence:CCGGGCCAAGGGAATAAGGAACGTTCTCGAGAACGTTCCTTATTCCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053257.3-547s21c1
Sequence:CCGGGGTCTACAGGGTGTTGGAAATCTCGAGATTTCCAACACCCTGTAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435899    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053257.3-599s21c1
Sequence:CCGGGAAATTAGAAATACGTGAAACCTCGAGGTTTCACGTATTTCTAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000993
VALIDATED
RPL31 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein L31
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000993.2-213s1c1
Sequence:CCGGGCGCATTGACACCAGGCTCAACTCGAGTTGAGCCTGGTGTCAATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000993.2-160s1c1
Sequence:CCGGGCACTCAAAGAGATTCGGAAACTCGAGTTTCCGAATCTCTTTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000993.2-93s1c1
Sequence:CCGGCCGAGAATACACCATCAACATCTCGAGATGTTGATGGTGTATTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000993.2-81s1c1
Sequence:CCGGCGAAGTGGTAACCCGAGAATACTCGAGTATTCTCGGGTTACCACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000993.2-252s1c1
Sequence:CCGGAGGAATAAGGAATGTGCCATACTCGAGTATGGCACATTCCTTATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000993.4-141s21c1
Sequence:CCGGCGAAGTGGTAACCCGAGAATACTCGAGTATTCTCGGGTTACCACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000993.4-220s21c1
Sequence:CCGGGCACTCAAAGAGATTCGGAAACTCGAGTTTCCGAATCTCTTTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000993.4-312s21c1
Sequence:CCGGAGGAATAAGGAATGTGCCATACTCGAGTATGGCACATTCCTTATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000993.4-273s21c1
Sequence:CCGGGCGCATTGACACCAGGCTCAACTCGAGTTGAGCCTGGTGTCAATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000993
VALIDATED
RPL31 MISSION shRNA shRNA Plasmid DNA
ribosomal protein L31
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000993.2-213s1c1
Sequence:CCGGGCGCATTGACACCAGGCTCAACTCGAGTTGAGCCTGGTGTCAATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000993.2-160s1c1
Sequence:CCGGGCACTCAAAGAGATTCGGAAACTCGAGTTTCCGAATCTCTTTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000993.2-93s1c1
Sequence:CCGGCCGAGAATACACCATCAACATCTCGAGATGTTGATGGTGTATTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000993.2-81s1c1
Sequence:CCGGCGAAGTGGTAACCCGAGAATACTCGAGTATTCTCGGGTTACCACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000993.2-252s1c1
Sequence:CCGGAGGAATAAGGAATGTGCCATACTCGAGTATGGCACATTCCTTATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000993.4-141s21c1
Sequence:CCGGCGAAGTGGTAACCCGAGAATACTCGAGTATTCTCGGGTTACCACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000993.4-220s21c1
Sequence:CCGGGCACTCAAAGAGATTCGGAAACTCGAGTTTCCGAATCTCTTTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000993.4-312s21c1
Sequence:CCGGAGGAATAAGGAATGTGCCATACTCGAGTATGGCACATTCCTTATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000993.4-273s21c1
Sequence:CCGGGCGCATTGACACCAGGCTCAACTCGAGTTGAGCCTGGTGTCAATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000993
VALIDATED
RPL31 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein L31
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000993.2-213s1c1
Sequence:CCGGGCGCATTGACACCAGGCTCAACTCGAGTTGAGCCTGGTGTCAATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000993.2-160s1c1
Sequence:CCGGGCACTCAAAGAGATTCGGAAACTCGAGTTTCCGAATCTCTTTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000993.2-93s1c1
Sequence:CCGGCCGAGAATACACCATCAACATCTCGAGATGTTGATGGTGTATTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000993.2-81s1c1
Sequence:CCGGCGAAGTGGTAACCCGAGAATACTCGAGTATTCTCGGGTTACCACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000993.2-252s1c1
Sequence:CCGGAGGAATAAGGAATGTGCCATACTCGAGTATGGCACATTCCTTATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000993.4-141s21c1
Sequence:CCGGCGAAGTGGTAACCCGAGAATACTCGAGTATTCTCGGGTTACCACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000993.4-220s21c1
Sequence:CCGGGCACTCAAAGAGATTCGGAAACTCGAGTTTCCGAATCTCTTTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000993.4-312s21c1
Sequence:CCGGAGGAATAAGGAATGTGCCATACTCGAGTATGGCACATTCCTTATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000993.4-273s21c1
Sequence:CCGGGCGCATTGACACCAGGCTCAACTCGAGTTGAGCCTGGTGTCAATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks