EMAIL THIS PAGE TO A FRIEND

RPL32

ribosomal protein L32

Synonyms: L32
UniProtKB ID: P62910, B2R4Q3, P02433
Gene ID:
Human(6161) Summary: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L32E family of ribosomal proteins. It is located in the cytoplasm. Although some studies have mapped this gene to 3q13.3-q21, it is believed to map to 3p25-p24. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternatively spliced transcript variants encoding the same protein have been observed for this gene. [provided by RefSeq, Jul 2008]
Mouse(19951) ribosomal protein L32
Rat(28298) ribosomal protein L32
fruit fly(43573) Ribosomal protein L32
Thale Cress(844704) ribosomal protein L32
domestic cat(101096962) ribosomal protein L32
dog(607481) ribosomal protein L32
Zebrafish(556556) ribosomal protein L32
chicken(416122) ribosomal protein L32
domestic guinea pig(100721117) ribosomal protein L32
naked mole-rat(101723829) ribosomal protein L32
Domestic Rabbit(100328901) ribosomal protein L32
cow(615556) ribosomal protein L32
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172086 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172086 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172086 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000994 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000994 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000994 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000994 Rosetta Predictions human pricing
NM_001007073 Rosetta Predictions human pricing
NM_001007074 Rosetta Predictions human pricing
NM_013226 Rosetta Predictions rat pricing
NM_172086 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000994 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227904 predicted 544
2 SASI_Hs01_00227905 predicted 868
3 SASI_Hs01_00227906 predicted 863
4 SASI_Hs01_00227907 predicted 915
5 SASI_Hs01_00227909 predicted 826
6 SASI_Hs01_00227910 predicted 900
7 SASI_Hs01_00227912 predicted 861
8 SASI_Hs01_00227913 predicted 906
9 SASI_Hs02_00303682 predicted 942
10 SASI_Hs02_00303683 predicted 800
11 SASI_Hs01_00227908 predicted 436
12 SASI_Hs01_00227911 predicted 599
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007073 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196006 predicted 643
2 SASI_Hs01_00196007 predicted 967
3 SASI_Hs01_00196008 predicted 964
4 SASI_Hs01_00196009 predicted 1010
5 SASI_Hs01_00196011 predicted 921
6 SASI_Hs01_00196012 predicted 995
7 SASI_Hs01_00196014 predicted 963
8 SASI_Hs01_00196015 predicted 1004
9 SASI_Hs02_00305211 predicted 1043
10 SASI_Hs02_00305212 predicted 906
11 SASI_Hs01_00196010 predicted 543
12 SASI_Hs01_00196013 predicted 697
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007074 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154600 predicted 670
2 SASI_Hs01_00154601 predicted 983
3 SASI_Hs01_00154602 predicted 984
4 SASI_Hs01_00154603 predicted 1028
5 SASI_Hs01_00154605 predicted 941
6 SASI_Hs01_00154606 predicted 1020
7 SASI_Hs01_00154608 predicted 980
8 SASI_Hs01_00154609 predicted 1022
9 SASI_Hs02_00305213 predicted 1059
10 SASI_Hs02_00305214 predicted 923
11 SASI_Hs01_00154604 predicted 563
12 SASI_Hs01_00154607 predicted 718
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013226 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261111 predicted 274
2 SASI_Rn02_00261112 predicted 273
3 SASI_Rn02_00261113 predicted 270
4 SASI_Rn02_00261114 predicted 278
5 SASI_Rn02_00261115 predicted 277
6 SASI_Rn02_00261116 predicted 176
7 SASI_Rn01_00067508 predicted 142
8 SASI_Rn02_00261117 predicted 450
9 SASI_Rn01_00067500 predicted 228
10 SASI_Rn01_00067501 predicted 259
11 SASI_Rn01_00067502 predicted 232
12 SASI_Rn01_00067503 predicted 222
13 SASI_Rn01_00067504 predicted 226
14 SASI_Rn01_00067505 predicted 225
15 SASI_Rn01_00067506 predicted 101
16 SASI_Rn01_00067507 predicted 398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172086 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343648 predicted 157
2 SASI_Mm01_00123532 predicted 265
3 SASI_Mm01_00123533 predicted 229
4 SASI_Mm01_00123534 predicted 223
5 SASI_Mm01_00123535 predicted 223
6 SASI_Mm01_00123536 predicted 222
7 SASI_Mm01_00123537 predicted 219
8 SASI_Mm01_00123538 predicted 267
9 SASI_Mm01_00123539 predicted 260
10 SASI_Mm01_00123540 predicted 223
11 SASI_Mm01_00123541 predicted 226
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172086
VALIDATED
RPL32 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein L32
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172086.2-173s21c1
Sequence:CCGGTTGACAACAGGGTGCGGAGAACTCGAGTTCTCCGCACCCTGTTGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172086.2-115s21c1
Sequence:CCGGAGGCACCAGTCAGACCGATATCTCGAGATATCGGTCTGACTGGTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172086.2-311s21c1
Sequence:CCGGTGCTGCTGATGTGCAACAAATCTCGAGATTTGTTGCACATCAGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172086.1-223s1c1
Sequence:CCGGCATCGGTTATGGGAGCAACAACTCGAGTTGTTGCTCCCATAACCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172086.1-328s1c1
Sequence:CCGGCAAATCTTACTGTGCTGAGATCTCGAGATCTCAGCACAGTAAGATTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172086.1-337s1c1
Sequence:CCGGCTGTGCTGAGATTGCTCACAACTCGAGTTGTGAGCAATCTCAGCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172086.1-212s1c1
Sequence:CCGGCTGATGCCCAACATCGGTTATCTCGAGATAACCGATGTTGGGCATCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172086.1-275s1c1
Sequence:CCGGCGCAAGTTCCTGGTCCACAATCTCGAGATTGTGGACCAGGAACTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172086
VALIDATED
RPL32 MISSION shRNA shRNA Plasmid DNA
ribosomal protein L32
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172086.2-173s21c1
Sequence:CCGGTTGACAACAGGGTGCGGAGAACTCGAGTTCTCCGCACCCTGTTGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172086.2-115s21c1
Sequence:CCGGAGGCACCAGTCAGACCGATATCTCGAGATATCGGTCTGACTGGTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172086.2-311s21c1
Sequence:CCGGTGCTGCTGATGTGCAACAAATCTCGAGATTTGTTGCACATCAGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172086.1-223s1c1
Sequence:CCGGCATCGGTTATGGGAGCAACAACTCGAGTTGTTGCTCCCATAACCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172086.1-328s1c1
Sequence:CCGGCAAATCTTACTGTGCTGAGATCTCGAGATCTCAGCACAGTAAGATTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172086.1-337s1c1
Sequence:CCGGCTGTGCTGAGATTGCTCACAACTCGAGTTGTGAGCAATCTCAGCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172086.1-212s1c1
Sequence:CCGGCTGATGCCCAACATCGGTTATCTCGAGATAACCGATGTTGGGCATCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172086.1-275s1c1
Sequence:CCGGCGCAAGTTCCTGGTCCACAATCTCGAGATTGTGGACCAGGAACTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172086
VALIDATED
RPL32 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein L32
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172086.2-173s21c1
Sequence:CCGGTTGACAACAGGGTGCGGAGAACTCGAGTTCTCCGCACCCTGTTGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172086.2-115s21c1
Sequence:CCGGAGGCACCAGTCAGACCGATATCTCGAGATATCGGTCTGACTGGTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172086.2-311s21c1
Sequence:CCGGTGCTGCTGATGTGCAACAAATCTCGAGATTTGTTGCACATCAGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172086.1-223s1c1
Sequence:CCGGCATCGGTTATGGGAGCAACAACTCGAGTTGTTGCTCCCATAACCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172086.1-328s1c1
Sequence:CCGGCAAATCTTACTGTGCTGAGATCTCGAGATCTCAGCACAGTAAGATTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172086.1-337s1c1
Sequence:CCGGCTGTGCTGAGATTGCTCACAACTCGAGTTGTGAGCAATCTCAGCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172086.1-212s1c1
Sequence:CCGGCTGATGCCCAACATCGGTTATCTCGAGATAACCGATGTTGGGCATCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172086.1-275s1c1
Sequence:CCGGCGCAAGTTCCTGGTCCACAATCTCGAGATTGTGGACCAGGAACTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000994
VALIDATED
RPL32 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein L32
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000420775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000994.3-849s21c1
Sequence:CCGGTAAAGTTAGGTGACAAGTTATCTCGAGATAACTTGTCACCTAACTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000994.3-185s21c1
Sequence:CCGGATTAAGCGTAACTGGCGGAAACTCGAGTTTCCGCCAGTTACGCTTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000994.2-169s1c1
Sequence:CCGGGCATTGACAACAGGGTTCGTACTCGAGTACGAACCCTGTTGTCAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000994.2-203s1c1
Sequence:CCGGCCAGATCTTGATGCCCAACATCTCGAGATGTTGGGCATCAAGATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000994.2-314s1c1
Sequence:CCGGGCTGATGTGCAACAAATCTTACTCGAGTAAGATTTGTTGCACATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000994.2-179s1c1
Sequence:CCGGCAGGGTTCGTAGAAGATTCAACTCGAGTTGAATCTTCTACGAACCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000994
VALIDATED
RPL32 MISSION shRNA shRNA Plasmid DNA
ribosomal protein L32
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000420775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000994.3-849s21c1
Sequence:CCGGTAAAGTTAGGTGACAAGTTATCTCGAGATAACTTGTCACCTAACTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000994.3-185s21c1
Sequence:CCGGATTAAGCGTAACTGGCGGAAACTCGAGTTTCCGCCAGTTACGCTTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000994.2-169s1c1
Sequence:CCGGGCATTGACAACAGGGTTCGTACTCGAGTACGAACCCTGTTGTCAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000994.2-203s1c1
Sequence:CCGGCCAGATCTTGATGCCCAACATCTCGAGATGTTGGGCATCAAGATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000994.2-314s1c1
Sequence:CCGGGCTGATGTGCAACAAATCTTACTCGAGTAAGATTTGTTGCACATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000994.2-179s1c1
Sequence:CCGGCAGGGTTCGTAGAAGATTCAACTCGAGTTGAATCTTCTACGAACCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000994
VALIDATED
RPL32 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein L32
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000420775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000994.3-849s21c1
Sequence:CCGGTAAAGTTAGGTGACAAGTTATCTCGAGATAACTTGTCACCTAACTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000994.3-185s21c1
Sequence:CCGGATTAAGCGTAACTGGCGGAAACTCGAGTTTCCGCCAGTTACGCTTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000994.2-169s1c1
Sequence:CCGGGCATTGACAACAGGGTTCGTACTCGAGTACGAACCCTGTTGTCAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000994.2-203s1c1
Sequence:CCGGCCAGATCTTGATGCCCAACATCTCGAGATGTTGGGCATCAAGATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000994.2-314s1c1
Sequence:CCGGGCTGATGTGCAACAAATCTTACTCGAGTAAGATTTGTTGCACATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000994.2-179s1c1
Sequence:CCGGCAGGGTTCGTAGAAGATTCAACTCGAGTTGAATCTTCTACGAACCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks