EMAIL THIS PAGE TO A FRIEND

RPL35

ribosomal protein L35

Synonyms: L35
Gene ID:
Human(11224) Summary: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L29P family of ribosomal proteins. It is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Mouse(66489) ribosomal protein L35
Rat(296709) ribosomal protein L35
fruit fly(31483) Ribosomal protein L35
Zebrafish(192299) ribosomal protein L35
chicken(374133) ribosomal protein L35
domestic cat(101081766) ribosomal protein L35
dog(480729) ribosomal protein L35
domestic guinea pig(100733979) ribosomal protein L35
naked mole-rat(101717427) ribosomal protein L35
cow(515534) ribosomal protein L35
sheep(101112126) ribosomal protein L35
39 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007209 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007209 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007209 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025592 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025592 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025592 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007209 Rosetta Predictions human pricing
NM_212511 Rosetta Predictions rat pricing
NM_025592 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007209 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343189 predicted 205
2 SASI_Hs02_00343190 predicted 210
3 SASI_Hs02_00343191 predicted 208
4 SASI_Hs02_00343192 predicted 208
5 SASI_Hs02_00343193 predicted 207
6 SASI_Hs01_00151288 predicted 198
7 SASI_Hs02_00343194 predicted 198
8 SASI_Hs02_00343195 predicted 200
9 SASI_Hs01_00151289 predicted 382
10 SASI_Hs01_00151290 predicted 192
11 SASI_Hs01_00151291 predicted 187
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212511 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270512 predicted 129
2 SASI_Rn02_00270513 predicted 121
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025592 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184906 predicted 217
2 SASI_Mm01_00184907 predicted 205
3 SASI_Mm01_00184908 predicted 200
4 SASI_Mm01_00184909 predicted 204
5 SASI_Mm02_00328586 predicted 210
6 SASI_Mm01_00184910 predicted 217
7 SASI_Mm01_00184911 predicted 217
8 SASI_Mm01_00184912 predicted 201
9 SASI_Mm01_00184913 predicted 211
10 SASI_Mm01_00184914 predicted 204
11 SASI_Mm01_00184915 predicted 203
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007209
VALIDATED
RPL35 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein L35
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007209.3-87s21c1
Sequence:CCGGAGAAGGAGGAGCTGCTGAAACCTCGAGGTTTCAGCAGCTCCTCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007209.3-170s21c1
Sequence:CCGGGCCTCCAAGCTCTCTAAGATCCTCGAGGATCTTAGAGAGCTTGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007209.3-178s21c1
Sequence:CCGGGCTCTCTAAGATCCGAGTCGTCTCGAGACGACTCGGATCTTAGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007209.3-259s21c1
Sequence:CCGGGAAATTCTACAAGGGCAAGAACTCGAGTTCTTGCCCTTGTAGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007209.3-103s21c1
Sequence:CCGGGAAACAGCTGGACGACCTGAACTCGAGTTCAGGTCGTCCAGCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007209.3-186s21c1
Sequence:CCGGAGATCCGAGTCGTCCGGAAATCTCGAGATTTCCGGACGACTCGGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007209.2-212s1c1
Sequence:CCGGGCCCGTGTTCTCACAGTTATTCTCGAGAATAACTGTGAGAACACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007209.2-79s1c1
Sequence:CCGGCGGGAAGAAGAAGGAGGAGCTCTCGAGAGCTCCTCCTTCTTCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007209.2-301s1c1
Sequence:CCGGGCCTAAGAAGACACGTGCCATCTCGAGATGGCACGTGTCTTCTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007209.2-227s1c1
Sequence:CCGGGTTATTAACCAGACTCAGAAACTCGAGTTTCTGAGTCTGGTTAATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007209.2-200s1c1
Sequence:CCGGCGGAAATCCATTGCCCGTGTTCTCGAGAACACGGGCAATGGATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007209
VALIDATED
RPL35 MISSION shRNA shRNA Plasmid DNA
ribosomal protein L35
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007209.3-87s21c1
Sequence:CCGGAGAAGGAGGAGCTGCTGAAACCTCGAGGTTTCAGCAGCTCCTCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007209.3-170s21c1
Sequence:CCGGGCCTCCAAGCTCTCTAAGATCCTCGAGGATCTTAGAGAGCTTGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007209.3-178s21c1
Sequence:CCGGGCTCTCTAAGATCCGAGTCGTCTCGAGACGACTCGGATCTTAGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007209.3-259s21c1
Sequence:CCGGGAAATTCTACAAGGGCAAGAACTCGAGTTCTTGCCCTTGTAGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007209.3-103s21c1
Sequence:CCGGGAAACAGCTGGACGACCTGAACTCGAGTTCAGGTCGTCCAGCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007209.3-186s21c1
Sequence:CCGGAGATCCGAGTCGTCCGGAAATCTCGAGATTTCCGGACGACTCGGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007209.2-212s1c1
Sequence:CCGGGCCCGTGTTCTCACAGTTATTCTCGAGAATAACTGTGAGAACACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007209.2-79s1c1
Sequence:CCGGCGGGAAGAAGAAGGAGGAGCTCTCGAGAGCTCCTCCTTCTTCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007209.2-301s1c1
Sequence:CCGGGCCTAAGAAGACACGTGCCATCTCGAGATGGCACGTGTCTTCTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007209.2-227s1c1
Sequence:CCGGGTTATTAACCAGACTCAGAAACTCGAGTTTCTGAGTCTGGTTAATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007209.2-200s1c1
Sequence:CCGGCGGAAATCCATTGCCCGTGTTCTCGAGAACACGGGCAATGGATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007209
VALIDATED
RPL35 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein L35
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007209.3-87s21c1
Sequence:CCGGAGAAGGAGGAGCTGCTGAAACCTCGAGGTTTCAGCAGCTCCTCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007209.3-170s21c1
Sequence:CCGGGCCTCCAAGCTCTCTAAGATCCTCGAGGATCTTAGAGAGCTTGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007209.3-178s21c1
Sequence:CCGGGCTCTCTAAGATCCGAGTCGTCTCGAGACGACTCGGATCTTAGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007209.3-259s21c1
Sequence:CCGGGAAATTCTACAAGGGCAAGAACTCGAGTTCTTGCCCTTGTAGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007209.3-103s21c1
Sequence:CCGGGAAACAGCTGGACGACCTGAACTCGAGTTCAGGTCGTCCAGCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007209.3-186s21c1
Sequence:CCGGAGATCCGAGTCGTCCGGAAATCTCGAGATTTCCGGACGACTCGGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007209.2-212s1c1
Sequence:CCGGGCCCGTGTTCTCACAGTTATTCTCGAGAATAACTGTGAGAACACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007209.2-79s1c1
Sequence:CCGGCGGGAAGAAGAAGGAGGAGCTCTCGAGAGCTCCTCCTTCTTCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007209.2-301s1c1
Sequence:CCGGGCCTAAGAAGACACGTGCCATCTCGAGATGGCACGTGTCTTCTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007209.2-227s1c1
Sequence:CCGGGTTATTAACCAGACTCAGAAACTCGAGTTTCTGAGTCTGGTTAATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007209.2-200s1c1
Sequence:CCGGCGGAAATCCATTGCCCGTGTTCTCGAGAACACGGGCAATGGATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025592
RPL35 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein L35
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025592.2-211s1c1
Sequence:CCGGCCGAGTCCTCACTGTTATTAACTCGAGTTAATAACAGTGAGGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025592.2-253s1c1
Sequence:CCGGCAGGAAATTCTACAAGGGCAACTCGAGTTGCCCTTGTAGAATTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025592.2-222s1c1
Sequence:CCGGCTGTTATTAACCAGACTCAAACTCGAGTTTGAGTCTGGTTAATAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025592.2-176s1c1
Sequence:CCGGCTCTCCAAGATACGAGTCGTTCTCGAGAACGACTCGTATCTTGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025592.2-95s1c1
Sequence:CCGGCTGTTGAAACAACTGGACGATCTCGAGATCGTCCAGTTGTTTCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025592
RPL35 MISSION shRNA shRNA Plasmid DNA
ribosomal protein L35
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025592.2-211s1c1
Sequence:CCGGCCGAGTCCTCACTGTTATTAACTCGAGTTAATAACAGTGAGGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025592.2-253s1c1
Sequence:CCGGCAGGAAATTCTACAAGGGCAACTCGAGTTGCCCTTGTAGAATTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025592.2-222s1c1
Sequence:CCGGCTGTTATTAACCAGACTCAAACTCGAGTTTGAGTCTGGTTAATAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025592.2-176s1c1
Sequence:CCGGCTCTCCAAGATACGAGTCGTTCTCGAGAACGACTCGTATCTTGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025592.2-95s1c1
Sequence:CCGGCTGTTGAAACAACTGGACGATCTCGAGATCGTCCAGTTGTTTCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025592
RPL35 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein L35
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025592.2-211s1c1
Sequence:CCGGCCGAGTCCTCACTGTTATTAACTCGAGTTAATAACAGTGAGGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025592.2-253s1c1
Sequence:CCGGCAGGAAATTCTACAAGGGCAACTCGAGTTGCCCTTGTAGAATTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025592.2-222s1c1
Sequence:CCGGCTGTTATTAACCAGACTCAAACTCGAGTTTGAGTCTGGTTAATAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025592.2-176s1c1
Sequence:CCGGCTCTCCAAGATACGAGTCGTTCTCGAGAACGACTCGTATCTTGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025592.2-95s1c1
Sequence:CCGGCTGTTGAAACAACTGGACGATCTCGAGATCGTCCAGTTGTTTCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks