EMAIL THIS PAGE TO A FRIEND

RPL36AL

ribosomal protein L36a-like

Synonyms: RPL36A
UniProtKB ID: Q969Q0, Q3B7A5
Gene ID:
Human(6166) Summary: Cytoplasmic ribosomes, organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein, which shares sequence similarity with yeast ribosomal protein L44, belongs to the L44E (L36AE) family of ribosomal proteins. This gene and the human gene officially named ribosomal protein L36a (RPL36A) encode nearly identical proteins; however, they are distinct genes. Although the name of this gene has been referred to as ribosomal protein L36a (RPL36A), its official name is ribosomal protein L36a-like (RPL36AL). As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Mouse(66483) ribosomal protein L36A-like
Rat(81769) ribosomal protein L36a-like
cow(613592) ribosomal protein L36a-like
chicken(422189) ribosomal protein L36a-like
dog(480311) ribosomal protein L36a-like
31 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025589 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025589 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025589 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001001 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031105 Rosetta Predictions rat pricing
NM_025589 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031105 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046066 predicted 222
2 SASI_Rn01_00046068 predicted 199
3 SASI_Rn01_00046069 predicted 234
4 SASI_Rn01_00046070 predicted 228
5 SASI_Rn01_00046071 predicted 219
6 SASI_Rn01_00046072 predicted 227
7 SASI_Rn01_00046074 predicted 221
8 SASI_Rn02_00264385 predicted 195
9 SASI_Rn02_00264386 predicted 227
10 SASI_Rn02_00264387 predicted 217
11 SASI_Rn01_00046065 predicted 233
12 SASI_Rn01_00046067 predicted 204
13 SASI_Rn01_00046073 predicted 212
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025589 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057430 predicted 195
2 SASI_Mm01_00057431 predicted 199
3 SASI_Mm01_00057432 predicted 196
4 SASI_Mm01_00057433 predicted 202
5 SASI_Mm01_00057434 predicted 196
6 SASI_Mm01_00057435 predicted 245
7 SASI_Mm01_00057436 predicted 245
8 SASI_Mm01_00057437 predicted 235
9 SASI_Mm01_00057438 predicted 240
10 SASI_Mm01_00057439 predicted 221
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025589
VALIDATED
RPL36AL MISSION shRNA Bacterial Glycerol Stock
ribosomal protein L36a-like
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025589.4-351s21c1
Sequence:CCGGCAAGAGGATGCTGGCCATTAACTCGAGTTAATGGCCAGCATCCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025589.4-174s21c1
Sequence:CCGGTCACAAAGTGACCCAGTATAACTCGAGTTATACTGGGTCACTTTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025589.4-321s21c1
Sequence:CCGGGCTTGAGTGTGTTGAGCCCAACTCGAGTTGGGCTCAACACACTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025589.4-267s21c1
Sequence:CCGGGACAAAGCCAATCTTTCGAAACTCGAGTTTCGAAAGATTGGCTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025589.1-147s1c1
Sequence:CCGGCCTCACAAAGTGACCCAGTATCTCGAGATACTGGGTCACTTTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025589.1-123s1c1
Sequence:CCGGTGTAAGAAATGTGGCAAGCATCTCGAGATGCTTGCCACATTTCTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025589.1-296s1c1
Sequence:CCGGGCTTGAGTGTGTTGAGCCCAACTCGAGTTGGGCTCAACACACTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025589.1-242s1c1
Sequence:CCGGGACAAAGCCAATCTTTCGAAACTCGAGTTTCGAAAGATTGGCTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025589.1-149s1c1
Sequence:CCGGTCACAAAGTGACCCAGTATAACTCGAGTTATACTGGGTCACTTTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025589
VALIDATED
RPL36AL MISSION shRNA shRNA Plasmid DNA
ribosomal protein L36a-like
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025589.4-351s21c1
Sequence:CCGGCAAGAGGATGCTGGCCATTAACTCGAGTTAATGGCCAGCATCCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025589.4-174s21c1
Sequence:CCGGTCACAAAGTGACCCAGTATAACTCGAGTTATACTGGGTCACTTTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025589.4-321s21c1
Sequence:CCGGGCTTGAGTGTGTTGAGCCCAACTCGAGTTGGGCTCAACACACTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025589.4-267s21c1
Sequence:CCGGGACAAAGCCAATCTTTCGAAACTCGAGTTTCGAAAGATTGGCTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025589.1-147s1c1
Sequence:CCGGCCTCACAAAGTGACCCAGTATCTCGAGATACTGGGTCACTTTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025589.1-123s1c1
Sequence:CCGGTGTAAGAAATGTGGCAAGCATCTCGAGATGCTTGCCACATTTCTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025589.1-296s1c1
Sequence:CCGGGCTTGAGTGTGTTGAGCCCAACTCGAGTTGGGCTCAACACACTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025589.1-242s1c1
Sequence:CCGGGACAAAGCCAATCTTTCGAAACTCGAGTTTCGAAAGATTGGCTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025589.1-149s1c1
Sequence:CCGGTCACAAAGTGACCCAGTATAACTCGAGTTATACTGGGTCACTTTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025589
VALIDATED
RPL36AL MISSION shRNA Lentiviral Transduction Particles
ribosomal protein L36a-like
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025589.4-351s21c1
Sequence:CCGGCAAGAGGATGCTGGCCATTAACTCGAGTTAATGGCCAGCATCCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025589.4-174s21c1
Sequence:CCGGTCACAAAGTGACCCAGTATAACTCGAGTTATACTGGGTCACTTTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025589.4-321s21c1
Sequence:CCGGGCTTGAGTGTGTTGAGCCCAACTCGAGTTGGGCTCAACACACTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025589.4-267s21c1
Sequence:CCGGGACAAAGCCAATCTTTCGAAACTCGAGTTTCGAAAGATTGGCTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025589.1-147s1c1
Sequence:CCGGCCTCACAAAGTGACCCAGTATCTCGAGATACTGGGTCACTTTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025589.1-123s1c1
Sequence:CCGGTGTAAGAAATGTGGCAAGCATCTCGAGATGCTTGCCACATTTCTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025589.1-296s1c1
Sequence:CCGGGCTTGAGTGTGTTGAGCCCAACTCGAGTTGGGCTCAACACACTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025589.1-242s1c1
Sequence:CCGGGACAAAGCCAATCTTTCGAAACTCGAGTTTCGAAAGATTGGCTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025589.1-149s1c1
Sequence:CCGGTCACAAAGTGACCCAGTATAACTCGAGTTATACTGGGTCACTTTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001
VALIDATED
RPL36AL MISSION shRNA Bacterial Glycerol Stock
ribosomal protein L36a-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000333459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001.3-357s21c1
Sequence:CCGGCCATTAAGAGATGCAAGCATTCTCGAGAATGCTTGCATCTCTTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001.3-313s21c1
Sequence:CCGGGCTGGAATGTGTTGAGCCTAACTCGAGTTAGGCTCAACACATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001.3-291s21c1
Sequence:CCGGCCACAAAGAAGATTGTGCTAACTCGAGTTAGCACAATCTTCTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001.3-165s21c1
Sequence:CCGGCTCACAAAGTGACACAGTATACTCGAGTATACTGTGTCACTTTGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001.3-164s1c1
Sequence:CCGGCCTCACAAAGTGACACAGTATCTCGAGATACTGTGTCACTTTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001.3-357s1c1
Sequence:CCGGCCATTAAGAGATGCAAGCATTCTCGAGAATGCTTGCATCTCTTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001.3-313s1c1
Sequence:CCGGGCTGGAATGTGTTGAGCCTAACTCGAGTTAGGCTCAACACATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001.3-165s1c1
Sequence:CCGGCTCACAAAGTGACACAGTATACTCGAGTATACTGTGTCACTTTGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001.3-291s1c1
Sequence:CCGGCCACAAAGAAGATTGTGCTAACTCGAGTTAGCACAATCTTCTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001
VALIDATED
RPL36AL MISSION shRNA shRNA Plasmid DNA
ribosomal protein L36a-like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000333459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001.3-357s21c1
Sequence:CCGGCCATTAAGAGATGCAAGCATTCTCGAGAATGCTTGCATCTCTTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001.3-313s21c1
Sequence:CCGGGCTGGAATGTGTTGAGCCTAACTCGAGTTAGGCTCAACACATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001.3-291s21c1
Sequence:CCGGCCACAAAGAAGATTGTGCTAACTCGAGTTAGCACAATCTTCTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001.3-165s21c1
Sequence:CCGGCTCACAAAGTGACACAGTATACTCGAGTATACTGTGTCACTTTGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001.3-164s1c1
Sequence:CCGGCCTCACAAAGTGACACAGTATCTCGAGATACTGTGTCACTTTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001.3-357s1c1
Sequence:CCGGCCATTAAGAGATGCAAGCATTCTCGAGAATGCTTGCATCTCTTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001.3-313s1c1
Sequence:CCGGGCTGGAATGTGTTGAGCCTAACTCGAGTTAGGCTCAACACATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001.3-165s1c1
Sequence:CCGGCTCACAAAGTGACACAGTATACTCGAGTATACTGTGTCACTTTGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001.3-291s1c1
Sequence:CCGGCCACAAAGAAGATTGTGCTAACTCGAGTTAGCACAATCTTCTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001
VALIDATED
RPL36AL MISSION shRNA Lentiviral Transduction Particles
ribosomal protein L36a-like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000333459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001.3-357s21c1
Sequence:CCGGCCATTAAGAGATGCAAGCATTCTCGAGAATGCTTGCATCTCTTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001.3-313s21c1
Sequence:CCGGGCTGGAATGTGTTGAGCCTAACTCGAGTTAGGCTCAACACATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001.3-291s21c1
Sequence:CCGGCCACAAAGAAGATTGTGCTAACTCGAGTTAGCACAATCTTCTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001.3-165s21c1
Sequence:CCGGCTCACAAAGTGACACAGTATACTCGAGTATACTGTGTCACTTTGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001.3-164s1c1
Sequence:CCGGCCTCACAAAGTGACACAGTATCTCGAGATACTGTGTCACTTTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001.3-357s1c1
Sequence:CCGGCCATTAAGAGATGCAAGCATTCTCGAGAATGCTTGCATCTCTTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001.3-313s1c1
Sequence:CCGGGCTGGAATGTGTTGAGCCTAACTCGAGTTAGGCTCAACACATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001.3-165s1c1
Sequence:CCGGCTCACAAAGTGACACAGTATACTCGAGTATACTGTGTCACTTTGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001.3-291s1c1
Sequence:CCGGCCACAAAGAAGATTGTGCTAACTCGAGTTAGCACAATCTTCTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks