EMAIL THIS PAGE TO A FRIEND

RPL36AP8

ribosomal protein L36a pseudogene 8

Synonyms: RPL36A_20_1424
Species: Human RPL36AP8(643007)
Gene ID:
Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001101383
RPL36AP8 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein L36a pseudogene 8
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101383.1-57s21c1
Sequence:CCGGGGACTTTCTGTAAGAAGTGTGCTCGAGCACACTTCTTACAGAAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101383.1-215s21c1
Sequence:CCGGACTACAAAGATTGTGCTAAGGCTCGAGCCTTAGCACAATCTTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101383.1-177s21c1
Sequence:CCGGGTGGGCAAACTAAGCCAATTTCTCGAGAAATTGGCTTAGTTTGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101383.1-94s21c1
Sequence:CCGGTAAAGTGACACAGTACAAGAACTCGAGTTCTTGTACTGTGTCACTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101383.1-237s21c1
Sequence:CCGGTTGAGTGCATTGAGCCCAACTCTCGAGAGTTGGGCTCAATGCACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001101383
RPL36AP8 MISSION shRNA shRNA Plasmid DNA
ribosomal protein L36a pseudogene 8
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101383.1-57s21c1
Sequence:CCGGGGACTTTCTGTAAGAAGTGTGCTCGAGCACACTTCTTACAGAAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101383.1-215s21c1
Sequence:CCGGACTACAAAGATTGTGCTAAGGCTCGAGCCTTAGCACAATCTTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101383.1-177s21c1
Sequence:CCGGGTGGGCAAACTAAGCCAATTTCTCGAGAAATTGGCTTAGTTTGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101383.1-94s21c1
Sequence:CCGGTAAAGTGACACAGTACAAGAACTCGAGTTCTTGTACTGTGTCACTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101383.1-237s21c1
Sequence:CCGGTTGAGTGCATTGAGCCCAACTCTCGAGAGTTGGGCTCAATGCACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001101383
RPL36AP8 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein L36a pseudogene 8
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101383.1-57s21c1
Sequence:CCGGGGACTTTCTGTAAGAAGTGTGCTCGAGCACACTTCTTACAGAAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101383.1-215s21c1
Sequence:CCGGACTACAAAGATTGTGCTAAGGCTCGAGCCTTAGCACAATCTTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101383.1-177s21c1
Sequence:CCGGGTGGGCAAACTAAGCCAATTTCTCGAGAAATTGGCTTAGTTTGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101383.1-94s21c1
Sequence:CCGGTAAAGTGACACAGTACAAGAACTCGAGTTCTTGTACTGTGTCACTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101383.1-237s21c1
Sequence:CCGGTTGAGTGCATTGAGCCCAACTCTCGAGAGTTGGGCTCAATGCACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks