EMAIL THIS PAGE TO A FRIEND

RPL8

ribosomal protein L8

Synonyms: L8
Gene ID:
Human(6132) Summary: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L2P family of ribosomal proteins. It is located in the cytoplasm. In rat, the protein associates with the 5.8S rRNA, very likely participates in the binding of aminoacyl-tRNA, and is a constituent of the elongation factor 2-binding site at the ribosomal subunit interface. Alternatively spliced transcript variants encoding the same protein exist. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Mouse(26961) ribosomal protein L8
Rat(26962) ribosomal protein L8
fruit fly(44251) Ribosomal protein L8
domestic cat(101082467) ribosomal protein L8
dog(475130) ribosomal protein L8
chicken(418568) ribosomal protein L8
Zebrafish(393686) ribosomal protein L8
cow(535056) ribosomal protein L8
sheep(101111556) ribosomal protein L8
domestic guinea pig(100718642) ribosomal protein L8
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012053 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012053 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012053 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000973 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000973 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000973 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000973 Rosetta Predictions human pricing
NM_033301 Rosetta Predictions human pricing
NM_001034916 Rosetta Predictions rat pricing
NM_012053 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000973 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303617 predicted 477
2 SASI_Hs01_00148906 predicted 614
3 SASI_Hs01_00148908 predicted 577
4 SASI_Hs01_00148909 predicted 457
5 SASI_Hs02_00303618 predicted 552
6 SASI_Hs02_00303619 predicted 476
7 SASI_Hs02_00303620 predicted 463
8 SASI_Hs01_00148905 predicted 320
9 SASI_Hs02_00303621 predicted 333
10 SASI_Hs01_00148907 predicted 371
11 SASI_Hs01_00148910 predicted 527
12 SASI_Hs01_00148911 predicted 513
13 SASI_Hs01_00148912 predicted 354
14 SASI_Hs01_00148913 predicted 591
15 SASI_Hs01_00148914 predicted 648
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033301 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361116 predicted 517
2 SASI_Hs01_00202547 predicted 658
3 SASI_Hs01_00202549 predicted 628
4 SASI_Hs01_00202550 predicted 494
5 SASI_Hs02_00361117 predicted 597
6 SASI_Hs02_00361118 predicted 520
7 SASI_Hs02_00361119 predicted 511
8 SASI_Hs01_00202546 predicted 361
9 SASI_Hs02_00361120 predicted 377
10 SASI_Hs01_00202548 predicted 418
11 SASI_Hs01_00202551 predicted 564
12 SASI_Hs01_00202552 predicted 552
13 SASI_Hs01_00202553 predicted 397
14 SASI_Hs01_00202554 predicted 628
15 SASI_Hs01_00202555 predicted 692
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034916 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204051 predicted 283
2 SASI_Rn01_00052908 predicted 213
3 SASI_Rn02_00204052 predicted 222
4 SASI_Rn02_00204053 predicted 286
5 SASI_Rn01_00052909 predicted 360
6 SASI_Rn01_00052910 predicted 314
7 SASI_Rn01_00052911 predicted 344
8 SASI_Rn02_00204054 predicted 549
9 SASI_Rn02_00204055 predicted 418
10 SASI_Rn01_00052917 predicted 490
11 SASI_Rn01_00052912 predicted 510
12 SASI_Rn01_00052913 predicted 325
13 SASI_Rn01_00052914 predicted 314
14 SASI_Rn01_00052915 predicted 482
15 SASI_Rn01_00052916 predicted 453
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012053 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064381 predicted 203
2 SASI_Mm01_00064382 predicted 271
3 SASI_Mm01_00064383 predicted 357
4 SASI_Mm01_00064384 predicted 298
5 SASI_Mm01_00064385 predicted 301
6 SASI_Mm01_00064386 predicted 351
7 SASI_Mm01_00064387 predicted 299
8 SASI_Mm01_00064388 predicted 260
9 SASI_Mm01_00064389 predicted 443
10 SASI_Mm01_00064390 predicted 273
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012053
VALIDATED
RPL8 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein L8
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012053.1-576s21c1
Sequence:CCGGCTACCACAAGTACAAGGCAAACTCGAGTTTGCCTTGTACTTGTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012053.1-304s21c1
Sequence:CCGGCAGCTGAATATCGGCAATGTTCTCGAGAACATTGCCGATATTCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012053.1-685s21c1
Sequence:CCGGCCCTCCACCATCCGAAGAGATCTCGAGATCTCTTCGGATGGTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012053.1-137s21c1
Sequence:CCGGGCTACATTAAAGGCATCGTAACTCGAGTTACGATGCCTTTAATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012053.1-540s21c1
Sequence:CCGGCAGAATTGACAAGCCTATCTTCTCGAGAAGATAGGCTTGTCAATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012053.1-137s1c1
Sequence:CCGGGCTACATTAAAGGCATCGTAACTCGAGTTACGATGCCTTTAATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012053.1-576s1c1
Sequence:CCGGCTACCACAAGTACAAGGCAAACTCGAGTTTGCCTTGTACTTGTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012053.1-685s1c1
Sequence:CCGGCCCTCCACCATCCGAAGAGATCTCGAGATCTCTTCGGATGGTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012053.1-304s1c1
Sequence:CCGGCAGCTGAATATCGGCAATGTTCTCGAGAACATTGCCGATATTCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012053.1-540s1c1
Sequence:CCGGCAGAATTGACAAGCCTATCTTCTCGAGAAGATAGGCTTGTCAATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012053
VALIDATED
RPL8 MISSION shRNA shRNA Plasmid DNA
ribosomal protein L8
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012053.1-576s21c1
Sequence:CCGGCTACCACAAGTACAAGGCAAACTCGAGTTTGCCTTGTACTTGTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012053.1-304s21c1
Sequence:CCGGCAGCTGAATATCGGCAATGTTCTCGAGAACATTGCCGATATTCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012053.1-685s21c1
Sequence:CCGGCCCTCCACCATCCGAAGAGATCTCGAGATCTCTTCGGATGGTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012053.1-137s21c1
Sequence:CCGGGCTACATTAAAGGCATCGTAACTCGAGTTACGATGCCTTTAATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012053.1-540s21c1
Sequence:CCGGCAGAATTGACAAGCCTATCTTCTCGAGAAGATAGGCTTGTCAATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012053.1-137s1c1
Sequence:CCGGGCTACATTAAAGGCATCGTAACTCGAGTTACGATGCCTTTAATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012053.1-576s1c1
Sequence:CCGGCTACCACAAGTACAAGGCAAACTCGAGTTTGCCTTGTACTTGTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012053.1-685s1c1
Sequence:CCGGCCCTCCACCATCCGAAGAGATCTCGAGATCTCTTCGGATGGTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012053.1-304s1c1
Sequence:CCGGCAGCTGAATATCGGCAATGTTCTCGAGAACATTGCCGATATTCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012053.1-540s1c1
Sequence:CCGGCAGAATTGACAAGCCTATCTTCTCGAGAAGATAGGCTTGTCAATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012053
VALIDATED
RPL8 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein L8
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012053.1-576s21c1
Sequence:CCGGCTACCACAAGTACAAGGCAAACTCGAGTTTGCCTTGTACTTGTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012053.1-304s21c1
Sequence:CCGGCAGCTGAATATCGGCAATGTTCTCGAGAACATTGCCGATATTCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012053.1-685s21c1
Sequence:CCGGCCCTCCACCATCCGAAGAGATCTCGAGATCTCTTCGGATGGTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012053.1-137s21c1
Sequence:CCGGGCTACATTAAAGGCATCGTAACTCGAGTTACGATGCCTTTAATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012053.1-540s21c1
Sequence:CCGGCAGAATTGACAAGCCTATCTTCTCGAGAAGATAGGCTTGTCAATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012053.1-137s1c1
Sequence:CCGGGCTACATTAAAGGCATCGTAACTCGAGTTACGATGCCTTTAATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012053.1-576s1c1
Sequence:CCGGCTACCACAAGTACAAGGCAAACTCGAGTTTGCCTTGTACTTGTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012053.1-685s1c1
Sequence:CCGGCCCTCCACCATCCGAAGAGATCTCGAGATCTCTTCGGATGGTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012053.1-304s1c1
Sequence:CCGGCAGCTGAATATCGGCAATGTTCTCGAGAACATTGCCGATATTCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012053.1-540s1c1
Sequence:CCGGCAGAATTGACAAGCCTATCTTCTCGAGAAGATAGGCTTGTCAATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000973
VALIDATED
RPL8 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein L8
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000973.3-585s21c1
Sequence:CCGGCCGAATTGACAAACCCATCTTCTCGAGAAGATGGGTTTGTCAATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000973.3-619s21c1
Sequence:CCGGGCGTACCACAAATATAAGGCACTCGAGTGCCTTATATTTGTGGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000973.3-321s21c1
Sequence:CCGGCCAGTTTGTGTATTGCGGCAACTCGAGTTGCCGCAATACACAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000973.3-456s21c1
Sequence:CCGGAGGGAACTATGCCACCGTTATCTCGAGATAACGGTGGCATAGTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000973.2-284s1c1
Sequence:CCGGCCAGTTTGTGTATTGCGGCAACTCGAGTTGCCGCAATACACAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000973.2-582s1c1
Sequence:CCGGGCGTACCACAAATATAAGGCACTCGAGTGCCTTATATTTGTGGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000973.2-419s1c1
Sequence:CCGGAGGGAACTATGCCACCGTTATCTCGAGATAACGGTGGCATAGTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000973.2-583s1c1
Sequence:CCGGCGTACCACAAATATAAGGCAACTCGAGTTGCCTTATATTTGTGGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000973.2-548s1c1
Sequence:CCGGCCGAATTGACAAACCCATCTTCTCGAGAAGATGGGTTTGTCAATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000973
VALIDATED
RPL8 MISSION shRNA shRNA Plasmid DNA
ribosomal protein L8
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000973.3-585s21c1
Sequence:CCGGCCGAATTGACAAACCCATCTTCTCGAGAAGATGGGTTTGTCAATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000973.3-619s21c1
Sequence:CCGGGCGTACCACAAATATAAGGCACTCGAGTGCCTTATATTTGTGGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000973.3-321s21c1
Sequence:CCGGCCAGTTTGTGTATTGCGGCAACTCGAGTTGCCGCAATACACAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000973.3-456s21c1
Sequence:CCGGAGGGAACTATGCCACCGTTATCTCGAGATAACGGTGGCATAGTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000973.2-284s1c1
Sequence:CCGGCCAGTTTGTGTATTGCGGCAACTCGAGTTGCCGCAATACACAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000973.2-582s1c1
Sequence:CCGGGCGTACCACAAATATAAGGCACTCGAGTGCCTTATATTTGTGGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000973.2-419s1c1
Sequence:CCGGAGGGAACTATGCCACCGTTATCTCGAGATAACGGTGGCATAGTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000973.2-583s1c1
Sequence:CCGGCGTACCACAAATATAAGGCAACTCGAGTTGCCTTATATTTGTGGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000973.2-548s1c1
Sequence:CCGGCCGAATTGACAAACCCATCTTCTCGAGAAGATGGGTTTGTCAATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000973
VALIDATED
RPL8 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein L8
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000973.3-585s21c1
Sequence:CCGGCCGAATTGACAAACCCATCTTCTCGAGAAGATGGGTTTGTCAATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000973.3-619s21c1
Sequence:CCGGGCGTACCACAAATATAAGGCACTCGAGTGCCTTATATTTGTGGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000973.3-321s21c1
Sequence:CCGGCCAGTTTGTGTATTGCGGCAACTCGAGTTGCCGCAATACACAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000973.3-456s21c1
Sequence:CCGGAGGGAACTATGCCACCGTTATCTCGAGATAACGGTGGCATAGTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000973.2-284s1c1
Sequence:CCGGCCAGTTTGTGTATTGCGGCAACTCGAGTTGCCGCAATACACAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000973.2-582s1c1
Sequence:CCGGGCGTACCACAAATATAAGGCACTCGAGTGCCTTATATTTGTGGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000973.2-419s1c1
Sequence:CCGGAGGGAACTATGCCACCGTTATCTCGAGATAACGGTGGCATAGTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000973.2-583s1c1
Sequence:CCGGCGTACCACAAATATAAGGCAACTCGAGTTGCCTTATATTTGTGGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000973.2-548s1c1
Sequence:CCGGCCGAATTGACAAACCCATCTTCTCGAGAAGATGGGTTTGTCAATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks