EMAIL THIS PAGE TO A FRIEND

RPLP2

ribosomal protein, large, P2

Synonyms: D11S2243E LP2 P2 RPP2
UniProtKB ID: P05387, Q6FG96
Gene ID:
Human(6181) Summary: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal phosphoprotein that is a component of the 60S subunit. The protein, which is a functional equivalent of the E. coli L7/L12 ribosomal protein, belongs to the L12P family of ribosomal proteins. It plays an important role in the elongation step of protein synthesis. Unlike most ribosomal proteins, which are basic, the encoded protein is acidic. Its C-terminal end is nearly identical to the C-terminal ends of the ribosomal phosphoproteins P0 and P1. The P2 protein can interact with P0 and P1 to form a pentameric complex consisting of P1 and P2 dimers, and a P0 monomer. The protein is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Mouse(67186) ribosomal protein, large P2
Rat(140662) ribosomal protein, large P2
fruit fly(36855) Ribosomal protein LP2
Zebrafish(335629) ribosomal protein, large P2
chicken(426492) ribosomal protein, large, P2
Horse(100034001) ribosomal protein, large, P2
domestic cat(101098579) ribosomal protein, large, P2
dog(475991) ribosomal protein, large, P2
cow(286853) ribosomal protein, large, P2
sheep(101103196) ribosomal protein, large, P2
naked mole-rat(101702556) ribosomal protein, large, P2
domestic guinea pig(100716951) ribosomal protein, large, P2
192 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026020 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026020 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026020 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001004 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004 Rosetta Predictions human pricing
NM_001030021 Rosetta Predictions rat pricing
NM_026020 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229978 predicted 199
2 SASI_Hs01_00229979 predicted 252
3 SASI_Hs01_00229980 predicted 271
4 SASI_Hs01_00229981 predicted 260
5 SASI_Hs01_00229982 predicted 268
6 SASI_Hs01_00229983 predicted 252
7 SASI_Hs02_00304434 predicted 209
8 SASI_Hs02_00304435 predicted 213
9 SASI_Hs02_00304436 predicted 202
10 SASI_Hs02_00304437 predicted 231
11 SASI_Hs01_00229984 predicted 410
12 SASI_Hs01_00229985 predicted 406
13 SASI_Hs01_00229986 predicted 415
14 SASI_Hs01_00229987 predicted 421
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030021 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061643 predicted 198
2 SASI_Rn02_00203525 predicted 201
3 SASI_Rn01_00061644 predicted 198
4 SASI_Rn01_00061645 predicted 366
5 SASI_Rn01_00061646 predicted 166
6 SASI_Rn01_00061648 predicted 170
7 SASI_Rn01_00061649 predicted 342
8 SASI_Rn01_00061651 predicted 181
9 SASI_Rn02_00203526 predicted 166
10 SASI_Rn02_00203527 predicted 160
11 SASI_Rn01_00061647 predicted 356
12 SASI_Rn01_00061650 predicted 364
13 SASI_Rn01_00061652 predicted 361
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026020 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329486 predicted 214
2 SASI_Mm02_00329487 predicted 206
3 SASI_Mm02_00329488 predicted 210
4 SASI_Mm02_00329489 predicted 215
5 SASI_Mm01_00066594 predicted 192
6 SASI_Mm01_00066595 predicted 377
7 SASI_Mm01_00066597 predicted 364
8 SASI_Mm02_00329490 predicted 382
9 SASI_Mm02_00329491 predicted 383
10 SASI_Mm02_00329492 predicted 149
11 SASI_Mm01_00066588 predicted 140
12 SASI_Mm01_00066589 predicted 149
13 SASI_Mm01_00066590 predicted 357
14 SASI_Mm01_00066591 predicted 51
15 SASI_Mm01_00066592 predicted 158
16 SASI_Mm01_00066593 predicted 151
17 SASI_Mm01_00066596 predicted 89
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026020
VALIDATED
RPLP2 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein, large, P2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026020.2-539s1c1
Sequence:CCGGTGATCGGCTCAACAAGGTCATCTCGAGATGACCTTGTTGAGCCGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026020.2-545s1c1
Sequence:CCGGGCTCAACAAGGTCATCAGTGACTCGAGTCACTGATGACCTTGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026020.2-574s1c1
Sequence:CCGGGAAAGAACATTGAGGATGTCACTCGAGTGACATCCTCAATGTTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026020.2-562s1c1
Sequence:CCGGGTGAGCTGAATGGAAAGAACACTCGAGTGTTCTTTCCATTCAGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026020.2-486s1c1
Sequence:CCGGAGCGCCAAAGACATCAAGAAACTCGAGTTTCTTGATGTCTTTGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026020.6-114s21c1
Sequence:CCGGAGCGCCAAAGACATCAAGAAACTCGAGTTTCTTGATGTCTTTGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026020.6-167s21c1
Sequence:CCGGTGATCGGCTCAACAAGGTCATCTCGAGATGACCTTGTTGAGCCGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026020.6-202s21c1
Sequence:CCGGGAAAGAACATTGAGGATGTCACTCGAGTGACATCCTCAATGTTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026020.6-190s21c1
Sequence:CCGGGTGAGCTGAATGGAAAGAACACTCGAGTGTTCTTTCCATTCAGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026020
VALIDATED
RPLP2 MISSION shRNA shRNA Plasmid DNA
ribosomal protein, large, P2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026020.2-539s1c1
Sequence:CCGGTGATCGGCTCAACAAGGTCATCTCGAGATGACCTTGTTGAGCCGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026020.2-545s1c1
Sequence:CCGGGCTCAACAAGGTCATCAGTGACTCGAGTCACTGATGACCTTGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026020.2-574s1c1
Sequence:CCGGGAAAGAACATTGAGGATGTCACTCGAGTGACATCCTCAATGTTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026020.2-562s1c1
Sequence:CCGGGTGAGCTGAATGGAAAGAACACTCGAGTGTTCTTTCCATTCAGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026020.2-486s1c1
Sequence:CCGGAGCGCCAAAGACATCAAGAAACTCGAGTTTCTTGATGTCTTTGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026020.6-114s21c1
Sequence:CCGGAGCGCCAAAGACATCAAGAAACTCGAGTTTCTTGATGTCTTTGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026020.6-167s21c1
Sequence:CCGGTGATCGGCTCAACAAGGTCATCTCGAGATGACCTTGTTGAGCCGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026020.6-202s21c1
Sequence:CCGGGAAAGAACATTGAGGATGTCACTCGAGTGACATCCTCAATGTTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026020.6-190s21c1
Sequence:CCGGGTGAGCTGAATGGAAAGAACACTCGAGTGTTCTTTCCATTCAGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026020
VALIDATED
RPLP2 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein, large, P2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026020.2-539s1c1
Sequence:CCGGTGATCGGCTCAACAAGGTCATCTCGAGATGACCTTGTTGAGCCGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026020.2-545s1c1
Sequence:CCGGGCTCAACAAGGTCATCAGTGACTCGAGTCACTGATGACCTTGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026020.2-574s1c1
Sequence:CCGGGAAAGAACATTGAGGATGTCACTCGAGTGACATCCTCAATGTTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026020.2-562s1c1
Sequence:CCGGGTGAGCTGAATGGAAAGAACACTCGAGTGTTCTTTCCATTCAGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026020.2-486s1c1
Sequence:CCGGAGCGCCAAAGACATCAAGAAACTCGAGTTTCTTGATGTCTTTGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026020.6-114s21c1
Sequence:CCGGAGCGCCAAAGACATCAAGAAACTCGAGTTTCTTGATGTCTTTGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026020.6-167s21c1
Sequence:CCGGTGATCGGCTCAACAAGGTCATCTCGAGATGACCTTGTTGAGCCGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026020.6-202s21c1
Sequence:CCGGGAAAGAACATTGAGGATGTCACTCGAGTGACATCCTCAATGTTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026020.6-190s21c1
Sequence:CCGGGTGAGCTGAATGGAAAGAACACTCGAGTGTTCTTTCCATTCAGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004
RPLP2 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein, large, P2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004.2-242s1c1
Sequence:CCGGGCCCAGGGTATTGGCAAGCTTCTCGAGAAGCTTGCCAATACCCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004.2-251s1c1
Sequence:CCGGATTGGCAAGCTTGCCAGTGTACTCGAGTACACTGGCAAGCTTGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004.2-196s1c1
Sequence:CCGGCAAGGTTATCAGTGAGCTGAACTCGAGTTCAGCTCACTGATAACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004.2-151s1c1
Sequence:CCGGGATCTTGGACAGCGTGGGTATCTCGAGATACCCACGCTGTCCAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004.2-133s1c1
Sequence:CCGGCGCCAAGGACATCAAGAAGATCTCGAGATCTTCTTGATGTCCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004.3-419s21c1
Sequence:CCGGCAGATGATGACATGGGATTTGCTCGAGCAAATCCCATGTCATCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004.3-256s21c1
Sequence:CCGGATTGAAGACGTCATTGCCCAGCTCGAGCTGGGCAATGACGTCTTCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004.3-313s21c1
Sequence:CCGGGCTGTAGCCGTCTCTGCTGCCCTCGAGGGCAGCAGAGACGGCTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004.3-292s21c1
Sequence:CCGGGCCAGTGTACCTGCTGGTGGGCTCGAGCCCACCAGCAGGTACACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004.3-197s21c1
Sequence:CCGGGTATCGAGGCGGACGACGACCCTCGAGGGTCGTCGTCCGCCTCGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004.3-378s21c1
Sequence:CCGGAGAGGAGAAGAAAGATGAGAACTCGAGTTCTCATCTTTCTTCTCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004.3-214s21c1
Sequence:CCGGGACCGGCTCAACAAGGTTATCCTCGAGGATAACCTTGTTGAGCCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004
RPLP2 MISSION shRNA shRNA Plasmid DNA
ribosomal protein, large, P2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004.2-242s1c1
Sequence:CCGGGCCCAGGGTATTGGCAAGCTTCTCGAGAAGCTTGCCAATACCCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004.2-251s1c1
Sequence:CCGGATTGGCAAGCTTGCCAGTGTACTCGAGTACACTGGCAAGCTTGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004.2-196s1c1
Sequence:CCGGCAAGGTTATCAGTGAGCTGAACTCGAGTTCAGCTCACTGATAACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004.2-151s1c1
Sequence:CCGGGATCTTGGACAGCGTGGGTATCTCGAGATACCCACGCTGTCCAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004.2-133s1c1
Sequence:CCGGCGCCAAGGACATCAAGAAGATCTCGAGATCTTCTTGATGTCCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004.3-419s21c1
Sequence:CCGGCAGATGATGACATGGGATTTGCTCGAGCAAATCCCATGTCATCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004.3-256s21c1
Sequence:CCGGATTGAAGACGTCATTGCCCAGCTCGAGCTGGGCAATGACGTCTTCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004.3-313s21c1
Sequence:CCGGGCTGTAGCCGTCTCTGCTGCCCTCGAGGGCAGCAGAGACGGCTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004.3-292s21c1
Sequence:CCGGGCCAGTGTACCTGCTGGTGGGCTCGAGCCCACCAGCAGGTACACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004.3-197s21c1
Sequence:CCGGGTATCGAGGCGGACGACGACCCTCGAGGGTCGTCGTCCGCCTCGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004.3-378s21c1
Sequence:CCGGAGAGGAGAAGAAAGATGAGAACTCGAGTTCTCATCTTTCTTCTCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004.3-214s21c1
Sequence:CCGGGACCGGCTCAACAAGGTTATCCTCGAGGATAACCTTGTTGAGCCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004
RPLP2 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein, large, P2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004.2-242s1c1
Sequence:CCGGGCCCAGGGTATTGGCAAGCTTCTCGAGAAGCTTGCCAATACCCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004.2-251s1c1
Sequence:CCGGATTGGCAAGCTTGCCAGTGTACTCGAGTACACTGGCAAGCTTGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004.2-196s1c1
Sequence:CCGGCAAGGTTATCAGTGAGCTGAACTCGAGTTCAGCTCACTGATAACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004.2-151s1c1
Sequence:CCGGGATCTTGGACAGCGTGGGTATCTCGAGATACCCACGCTGTCCAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004.2-133s1c1
Sequence:CCGGCGCCAAGGACATCAAGAAGATCTCGAGATCTTCTTGATGTCCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004.3-419s21c1
Sequence:CCGGCAGATGATGACATGGGATTTGCTCGAGCAAATCCCATGTCATCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004.3-256s21c1
Sequence:CCGGATTGAAGACGTCATTGCCCAGCTCGAGCTGGGCAATGACGTCTTCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004.3-313s21c1
Sequence:CCGGGCTGTAGCCGTCTCTGCTGCCCTCGAGGGCAGCAGAGACGGCTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004.3-292s21c1
Sequence:CCGGGCCAGTGTACCTGCTGGTGGGCTCGAGCCCACCAGCAGGTACACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004.3-197s21c1
Sequence:CCGGGTATCGAGGCGGACGACGACCCTCGAGGGTCGTCGTCCGCCTCGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004.3-378s21c1
Sequence:CCGGAGAGGAGAAGAAAGATGAGAACTCGAGTTCTCATCTTTCTTCTCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004.3-214s21c1
Sequence:CCGGGACCGGCTCAACAAGGTTATCCTCGAGGATAACCTTGTTGAGCCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks