EMAIL THIS PAGE TO A FRIEND

RPS11

ribosomal protein S11

Synonyms: S11
UniProtKB ID: P62280, B2R4F5, P04643, Q498Y6, Q6IRY0
Gene ID:
Human(6205) Summary: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a member of the S17P family of ribosomal proteins that is a component of the 40S subunit. This gene is co-transcribed with the small nucleolar RNA gene U35B, which is located in the third intron. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed throughout the genome. [provided by RefSeq, Jul 2012]
Mouse(27207) ribosomal protein S11
Rat(81774) ribosomal protein S11
fruit fly(36321) Ribosomal protein S11
chicken(419049) ribosomal protein S11
domestic cat(101096935) ribosomal protein S11
dog(403684) ribosomal protein S11
Zebrafish(406686) ribosomal protein S11
Thale Cress(844726) 30S ribosomal protein S11
domestic guinea pig(100726921) ribosomal protein S11
naked mole-rat(101698209) ribosomal protein S11
cow(539196) ribosomal protein S11
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013725 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013725 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013725 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001015 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001015 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001015 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001015 Rosetta Predictions human pricing
NM_031110 Rosetta Predictions rat pricing
NM_013725 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100362 predicted 209
2 SASI_Hs01_00100368 predicted 376
3 SASI_Hs01_00100370 predicted 374
4 SASI_Hs02_00306630 predicted 321
5 SASI_Hs02_00306631 predicted 480
6 SASI_Hs01_00100361 predicted 309
7 SASI_Hs01_00100363 predicted 306
8 SASI_Hs01_00100364 predicted 335
9 SASI_Hs01_00100365 predicted 385
10 SASI_Hs01_00100366 predicted 294
11 SASI_Hs01_00100367 predicted 292
12 SASI_Hs01_00100369 predicted 332
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031110 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052644 predicted 272
2 SASI_Rn02_00264399 predicted 275
3 SASI_Rn01_00052645 predicted 280
4 SASI_Rn02_00264400 predicted 265
5 SASI_Rn02_00264401 predicted 261
6 SASI_Rn02_00264402 predicted 293
7 SASI_Rn02_00264403 predicted 264
8 SASI_Rn02_00264404 predicted 204
9 SASI_Rn02_00264405 predicted 264
10 SASI_Rn02_00264406 predicted 300
11 SASI_Rn01_00052646 predicted 489
12 SASI_Rn01_00052647 predicted 483
13 SASI_Rn01_00052648 predicted 491
14 SASI_Rn01_00052649 predicted 493
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013725 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322645 predicted 207
2 SASI_Mm02_00322646 predicted 212
3 SASI_Mm01_00116353 predicted 211
4 SASI_Mm01_00116354 predicted 194
5 SASI_Mm01_00116356 predicted 321
6 SASI_Mm02_00322647 predicted 215
7 SASI_Mm02_00322648 predicted 332
8 SASI_Mm02_00322649 predicted 324
9 SASI_Mm02_00322650 predicted 336
10 SASI_Mm02_00322651 predicted 335
11 SASI_Mm01_00116355 predicted 220
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013725
VALIDATED
RPS11 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein S11
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013725.3-424s21c1
Sequence:CCGGATGTACAGATCGGAGACATTGCTCGAGCAATGTCTCCGATCTGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013725.3-284s21c1
Sequence:CCGGCCTGTCTGGTGTCGTGACAAACTCGAGTTTGTCACGACACCAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013725.3-226s21c1
Sequence:CCGGGTACCTACATAGACAAGAAATCTCGAGATTTCTTGTCTATGTAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013725.3-335s21c1
Sequence:CCGGCCGGGACTATCTCCATTACATCTCGAGATGTAATGGAGATAGTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013725.3-357s21c1
Sequence:CCGGCGAAAGTACAATCGCTTTGAGCTCGAGCTCAAAGCGATTGTACTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013725.2-359s1c1
Sequence:CCGGCCGGGACTATCTCCATTACATCTCGAGATGTAATGGAGATAGTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013725.2-250s1c1
Sequence:CCGGGTACCTACATAGACAAGAAATCTCGAGATTTCTTGTCTATGTAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013725.2-191s1c1
Sequence:CCGGCCCTCGGTACTACAAGAACATCTCGAGATGTTCTTGTAGTACCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013725.2-308s1c1
Sequence:CCGGCCTGTCTGGTGTCGTGACAAACTCGAGTTTGTCACGACACCAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013725.2-227s1c1
Sequence:CCGGGACACCTAAAGAGGCCATTGACTCGAGTCAATGGCCTCTTTAGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013725
VALIDATED
RPS11 MISSION shRNA shRNA Plasmid DNA
ribosomal protein S11
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013725.3-424s21c1
Sequence:CCGGATGTACAGATCGGAGACATTGCTCGAGCAATGTCTCCGATCTGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013725.3-284s21c1
Sequence:CCGGCCTGTCTGGTGTCGTGACAAACTCGAGTTTGTCACGACACCAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013725.3-226s21c1
Sequence:CCGGGTACCTACATAGACAAGAAATCTCGAGATTTCTTGTCTATGTAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013725.3-335s21c1
Sequence:CCGGCCGGGACTATCTCCATTACATCTCGAGATGTAATGGAGATAGTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013725.3-357s21c1
Sequence:CCGGCGAAAGTACAATCGCTTTGAGCTCGAGCTCAAAGCGATTGTACTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013725.2-359s1c1
Sequence:CCGGCCGGGACTATCTCCATTACATCTCGAGATGTAATGGAGATAGTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013725.2-250s1c1
Sequence:CCGGGTACCTACATAGACAAGAAATCTCGAGATTTCTTGTCTATGTAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013725.2-191s1c1
Sequence:CCGGCCCTCGGTACTACAAGAACATCTCGAGATGTTCTTGTAGTACCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013725.2-308s1c1
Sequence:CCGGCCTGTCTGGTGTCGTGACAAACTCGAGTTTGTCACGACACCAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013725.2-227s1c1
Sequence:CCGGGACACCTAAAGAGGCCATTGACTCGAGTCAATGGCCTCTTTAGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013725
VALIDATED
RPS11 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein S11
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013725.3-424s21c1
Sequence:CCGGATGTACAGATCGGAGACATTGCTCGAGCAATGTCTCCGATCTGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013725.3-284s21c1
Sequence:CCGGCCTGTCTGGTGTCGTGACAAACTCGAGTTTGTCACGACACCAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013725.3-226s21c1
Sequence:CCGGGTACCTACATAGACAAGAAATCTCGAGATTTCTTGTCTATGTAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013725.3-335s21c1
Sequence:CCGGCCGGGACTATCTCCATTACATCTCGAGATGTAATGGAGATAGTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013725.3-357s21c1
Sequence:CCGGCGAAAGTACAATCGCTTTGAGCTCGAGCTCAAAGCGATTGTACTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013725.2-359s1c1
Sequence:CCGGCCGGGACTATCTCCATTACATCTCGAGATGTAATGGAGATAGTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013725.2-250s1c1
Sequence:CCGGGTACCTACATAGACAAGAAATCTCGAGATTTCTTGTCTATGTAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013725.2-191s1c1
Sequence:CCGGCCCTCGGTACTACAAGAACATCTCGAGATGTTCTTGTAGTACCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013725.2-308s1c1
Sequence:CCGGCCTGTCTGGTGTCGTGACAAACTCGAGTTTGTCACGACACCAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013725.2-227s1c1
Sequence:CCGGGACACCTAAAGAGGCCATTGACTCGAGTCAATGGCCTCTTTAGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001015
VALIDATED
RPS11 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein S11
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001015.3-238s21c1
Sequence:CCGGGCACCTACATTGACAAGAAATCTCGAGATTTCTTGTCAATGTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001015.3-347s21c1
Sequence:CCGGCCGAGACTATCTGCACTACATCTCGAGATGTAGTGCAGATAGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001015.3-323s21c1
Sequence:CCGGGATGCAGAGGACCATTGTCATCTCGAGATGACAATGGTCCTCTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001015.3-183s21c1
Sequence:CCGGCGGTACTACAAGAACATCGGTCTCGAGACCGATGTTCTTGTAGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001015.3-359s21c1
Sequence:CCGGGCACTACATCCGCAAGTACAACTCGAGTTGTACTTGCGGATGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001015.3-238s1c1
Sequence:CCGGGCACCTACATTGACAAGAAATCTCGAGATTTCTTGTCAATGTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001015.3-323s1c1
Sequence:CCGGGATGCAGAGGACCATTGTCATCTCGAGATGACAATGGTCCTCTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001015.3-359s1c1
Sequence:CCGGGCACTACATCCGCAAGTACAACTCGAGTTGTACTTGCGGATGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001015.3-347s1c1
Sequence:CCGGCCGAGACTATCTGCACTACATCTCGAGATGTAGTGCAGATAGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001015.3-183s1c1
Sequence:CCGGCGGTACTACAAGAACATCGGTCTCGAGACCGATGTTCTTGTAGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001015
VALIDATED
RPS11 MISSION shRNA shRNA Plasmid DNA
ribosomal protein S11
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001015.3-238s21c1
Sequence:CCGGGCACCTACATTGACAAGAAATCTCGAGATTTCTTGTCAATGTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001015.3-347s21c1
Sequence:CCGGCCGAGACTATCTGCACTACATCTCGAGATGTAGTGCAGATAGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001015.3-323s21c1
Sequence:CCGGGATGCAGAGGACCATTGTCATCTCGAGATGACAATGGTCCTCTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001015.3-183s21c1
Sequence:CCGGCGGTACTACAAGAACATCGGTCTCGAGACCGATGTTCTTGTAGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001015.3-359s21c1
Sequence:CCGGGCACTACATCCGCAAGTACAACTCGAGTTGTACTTGCGGATGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001015.3-238s1c1
Sequence:CCGGGCACCTACATTGACAAGAAATCTCGAGATTTCTTGTCAATGTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001015.3-323s1c1
Sequence:CCGGGATGCAGAGGACCATTGTCATCTCGAGATGACAATGGTCCTCTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001015.3-359s1c1
Sequence:CCGGGCACTACATCCGCAAGTACAACTCGAGTTGTACTTGCGGATGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001015.3-347s1c1
Sequence:CCGGCCGAGACTATCTGCACTACATCTCGAGATGTAGTGCAGATAGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001015.3-183s1c1
Sequence:CCGGCGGTACTACAAGAACATCGGTCTCGAGACCGATGTTCTTGTAGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001015
VALIDATED
RPS11 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein S11
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001015.3-238s21c1
Sequence:CCGGGCACCTACATTGACAAGAAATCTCGAGATTTCTTGTCAATGTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001015.3-347s21c1
Sequence:CCGGCCGAGACTATCTGCACTACATCTCGAGATGTAGTGCAGATAGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001015.3-323s21c1
Sequence:CCGGGATGCAGAGGACCATTGTCATCTCGAGATGACAATGGTCCTCTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001015.3-183s21c1
Sequence:CCGGCGGTACTACAAGAACATCGGTCTCGAGACCGATGTTCTTGTAGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001015.3-359s21c1
Sequence:CCGGGCACTACATCCGCAAGTACAACTCGAGTTGTACTTGCGGATGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001015.3-238s1c1
Sequence:CCGGGCACCTACATTGACAAGAAATCTCGAGATTTCTTGTCAATGTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001015.3-323s1c1
Sequence:CCGGGATGCAGAGGACCATTGTCATCTCGAGATGACAATGGTCCTCTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001015.3-359s1c1
Sequence:CCGGGCACTACATCCGCAAGTACAACTCGAGTTGTACTTGCGGATGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001015.3-347s1c1
Sequence:CCGGCCGAGACTATCTGCACTACATCTCGAGATGTAGTGCAGATAGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001015.3-183s1c1
Sequence:CCGGCGGTACTACAAGAACATCGGTCTCGAGACCGATGTTCTTGTAGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks