EMAIL THIS PAGE TO A FRIEND

RPS29

ribosomal protein S29

Synonyms: S29
UniProtKB ID: P62273, A8MZ73, P30054
Gene ID:
Human(6235) Summary: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit and a member of the S14P family of ribosomal proteins. The protein, which contains a C2-C2 zinc finger-like domain that can bind to zinc, can enhance the tumor suppressor activity of Ras-related protein 1A (KREV1). It is located in the cytoplasm. Variable expression of this gene in colorectal cancers compared to adjacent normal tissues has been observed, although no correlation between the level of expression and the severity of the disease has been found. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2013]
Mouse(20090) ribosomal protein S29
Rat(25348) ribosomal protein S29
fruit fly(41200) Ribosomal protein S29
chicken(776054) ribosomal protein S29
domestic cat(101091204) ribosomal protein S29
dog(610596) ribosomal protein S29
Zebrafish(405889) ribosomal protein S29
domestic guinea pig(100719236) ribosomal protein S29
naked mole-rat(101708932) ribosomal protein S29
cow(286884) ribosomal protein S29
sheep(101121859) ribosomal protein S29
98 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009093 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009093 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009093 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001032 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001032 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001032 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU117201 MISSION® esiRNA esiRNA human AL139099.3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001030001 Rosetta Predictions human pricing
NM_001032 Rosetta Predictions human pricing
NM_012876 Rosetta Predictions rat pricing
NM_009093 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030001 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117568 predicted 292
2 SASI_Hs01_00117570 predicted 214
3 SASI_Hs01_00117571 predicted 387
4 SASI_Hs01_00117572 predicted 347
5 SASI_Hs01_00117573 predicted 341
6 SASI_Hs01_00117575 predicted 390
7 SASI_Hs01_00117576 predicted 347
8 SASI_Hs02_00307620 predicted 398
9 SASI_Hs01_00117577 predicted 295
10 SASI_Hs02_00307621 predicted 335
11 SASI_Hs01_00117569 predicted 363
12 SASI_Hs01_00117574 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184744 predicted 202
2 SASI_Hs01_00184746 predicted 201
3 SASI_Hs01_00184745 predicted 84
4 SASI_Hs01_00184742 predicted 85
5 SASI_Hs01_00184743 predicted 81
6 SASI_Hs01_00184747 predicted 87
7 SASI_Hs01_00184748 predicted 240
8 SASI_Hs01_00184749 predicted 248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012876 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030171 predicted 275
2 SASI_Rn01_00030172 predicted 221
3 SASI_Rn01_00030173 predicted 179
4 SASI_Rn01_00030174 predicted 273
5 SASI_Rn02_00260381 predicted 169
6 SASI_Rn01_00030175 predicted 151
7 SASI_Rn01_00030176 predicted 245
8 SASI_Rn02_00260382 predicted 133
9 SASI_Rn02_00260383 predicted 172
10 SASI_Rn02_00260384 predicted 134
11 SASI_Rn01_00030177 predicted 231
12 SASI_Rn01_00030178 predicted 127
13 SASI_Rn01_00030179 predicted 266
14 SASI_Rn01_00030180 predicted 170
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009093 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315319 predicted 219
2 SASI_Mm02_00315320 predicted 219
3 SASI_Mm02_00315321 predicted 151
4 SASI_Mm02_00315322 predicted 184
5 SASI_Mm01_00086671 predicted 194
6 SASI_Mm02_00315323 predicted 170
7 SASI_Mm02_00315324 predicted 106
8 SASI_Mm02_00315325 predicted 207
9 SASI_Mm02_00315326 predicted 169
10 SASI_Mm02_00315327 predicted 179
11 SASI_Mm01_00086669 predicted 69
12 SASI_Mm01_00086670 predicted 63
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009093
RPS29 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein S29
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009093.1-43s1c1
Sequence:CCGGCCACGGAAGTTCGGCCAGGGTCTCGAGACCCTGGCCGAACTTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009093.1-102s1c1
Sequence:CCGGGATCCGCAAATACGGGCTGAACTCGAGTTCAGCCCGTATTTGCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009093.1-105s1c1
Sequence:CCGGCCGCAAATACGGGCTGAACATCTCGAGATGTTCAGCCCGTATTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009093.1-93s1c1
Sequence:CCGGCCACGGTCTGATCCGCAAATACTCGAGTATTTGCGGATCAGACCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009093.1-92s1c1
Sequence:CCGGGCCACGGTCTGATCCGCAAATCTCGAGATTTGCGGATCAGACCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009093
RPS29 MISSION shRNA shRNA Plasmid DNA
ribosomal protein S29
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009093.1-43s1c1
Sequence:CCGGCCACGGAAGTTCGGCCAGGGTCTCGAGACCCTGGCCGAACTTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009093.1-102s1c1
Sequence:CCGGGATCCGCAAATACGGGCTGAACTCGAGTTCAGCCCGTATTTGCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009093.1-105s1c1
Sequence:CCGGCCGCAAATACGGGCTGAACATCTCGAGATGTTCAGCCCGTATTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009093.1-93s1c1
Sequence:CCGGCCACGGTCTGATCCGCAAATACTCGAGTATTTGCGGATCAGACCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009093.1-92s1c1
Sequence:CCGGGCCACGGTCTGATCCGCAAATCTCGAGATTTGCGGATCAGACCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009093
RPS29 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein S29
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009093.1-43s1c1
Sequence:CCGGCCACGGAAGTTCGGCCAGGGTCTCGAGACCCTGGCCGAACTTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009093.1-102s1c1
Sequence:CCGGGATCCGCAAATACGGGCTGAACTCGAGTTCAGCCCGTATTTGCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009093.1-105s1c1
Sequence:CCGGCCGCAAATACGGGCTGAACATCTCGAGATGTTCAGCCCGTATTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009093.1-93s1c1
Sequence:CCGGCCACGGTCTGATCCGCAAATACTCGAGTATTTGCGGATCAGACCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009093.1-92s1c1
Sequence:CCGGGCCACGGTCTGATCCGCAAATCTCGAGATTTGCGGATCAGACCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001032
VALIDATED
RPS29 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein S29
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001032.2-180s1c1
Sequence:CCGGCGGTTTCATTAAGTTGGACTACTCGAGTAGTCCAACTTAATGAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001032.2-169s1c1
Sequence:CCGGGCGAAGGATATCGGTTTCATTCTCGAGAATGAAACCGATATCCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001032.2-147s1c1
Sequence:CCGGCCGCCAGTGTTTCCGTCAGTACTCGAGTACTGACGGAAACACTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001032.2-112s1c1
Sequence:CCGGCACGGTCTGATCCGGAAATATCTCGAGATATTTCCGGATCAGACCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001032.2-86s1c1
Sequence:CCGGGCTCTTGTCGTGTCTGTTCAACTCGAGTTGAACAGACACGACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001032
VALIDATED
RPS29 MISSION shRNA shRNA Plasmid DNA
ribosomal protein S29
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001032.2-180s1c1
Sequence:CCGGCGGTTTCATTAAGTTGGACTACTCGAGTAGTCCAACTTAATGAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001032.2-169s1c1
Sequence:CCGGGCGAAGGATATCGGTTTCATTCTCGAGAATGAAACCGATATCCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001032.2-147s1c1
Sequence:CCGGCCGCCAGTGTTTCCGTCAGTACTCGAGTACTGACGGAAACACTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001032.2-112s1c1
Sequence:CCGGCACGGTCTGATCCGGAAATATCTCGAGATATTTCCGGATCAGACCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001032.2-86s1c1
Sequence:CCGGGCTCTTGTCGTGTCTGTTCAACTCGAGTTGAACAGACACGACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001032
VALIDATED
RPS29 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein S29
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001032.2-180s1c1
Sequence:CCGGCGGTTTCATTAAGTTGGACTACTCGAGTAGTCCAACTTAATGAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001032.2-169s1c1
Sequence:CCGGGCGAAGGATATCGGTTTCATTCTCGAGAATGAAACCGATATCCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001032.2-147s1c1
Sequence:CCGGCCGCCAGTGTTTCCGTCAGTACTCGAGTACTGACGGAAACACTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001032.2-112s1c1
Sequence:CCGGCACGGTCTGATCCGGAAATATCTCGAGATATTTCCGGATCAGACCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001032.2-86s1c1
Sequence:CCGGGCTCTTGTCGTGTCTGTTCAACTCGAGTTGAACAGACACGACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks