EMAIL THIS PAGE TO A FRIEND

RPS6KA1

ribosomal protein S6 kinase, 90kDa, polypeptide 1

Synonyms: HU-1 MAPKAPK1A RSK RSK1
Gene ID:
Human(6195) Summary: This gene encodes a member of the RSK (ribosomal S6 kinase) family of serine/threonine kinases. This kinase contains 2 nonidentical kinase catalytic domains and phosphorylates various substrates, including members of the mitogen-activated kinase (MAPK) signalling pathway. The activity of this protein has been implicated in controlling cell growth and differentiation. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(20111) ribosomal protein S6 kinase polypeptide 1
Rat(81771) ribosomal protein S6 kinase polypeptide 1
cow(533908) ribosomal protein S6 kinase, 90kDa, polypeptide 1
sheep(101110124) ribosomal protein S6 kinase, 90kDa, polypeptide 1
domestic guinea pig(100728619) ribosomal protein S6 kinase, 90kDa, polypeptide 1
naked mole-rat(101712979) ribosomal protein S6 kinase, 90kDa, polypeptide 1
Domestic Rabbit(100358702) ribosomal protein S6 kinase, 90kDa, polypeptide 1
Zebrafish(777728) ribosomal protein S6 kinase a, polypeptide 1
chicken(386579) ribosomal protein S6 kinase, 90kDa, polypeptide 1
dog(487353) ribosomal protein S6 kinase, 90kDa, polypeptide 1
Horse(100057166) ribosomal protein S6 kinase, 90kDa, polypeptide 1
domestic cat(101086492) ribosomal protein S6 kinase, 90kDa, polypeptide 1
178 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4502679 Anti-p90 RSK antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunohistochemistry, western blot pricing
SAB4502680 Anti-p90 RSK antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
SAB4502681 Anti-p90 RSK, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
SAB4503960 Anti-phospho-p90 RSK (pSer380) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4503959 Anti-phospho-p90 RSK (pThr359+Ser363) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4503961 Anti-phospho-p90 RSK (pThr573) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4301239 Anti-phospho-p90 RSK (pThr573) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4300092 Anti-phospho-RPS6KA1 (pSer352) antibody produced in rabbit affinity isolated antibody human, rat, mouse
western blot pricing
SAB4300084 Anti-phospho-RPS6KA1 (pThr348) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
R6525 Anti-phospho-Rsk1 (p90rsk) (pSer381) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
immunocytochemistry, immunoprecipitation, western blot pricing
SAB4504643 Anti-phospho-RSK1/2/3/4 (pSer221/227/218/232) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB3500351 Anti-RPS6K1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ELISA, immunocytochemistry, immunofluorescence, western blot pricing
SAB4300407 Anti-RPS6KA1 (Ab-348) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunofluorescence, western blot pricing
SAB4300408 Anti-RPS6KA1 (Ab-352) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunohistochemistry, western blot pricing
HPA007981 Anti-RPS6KA1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, rat
immunofluorescence, immunohistochemistry, western blot pricing
R5145 Anti-Rsk1 antibody produced in rabbit whole antiserum mouse, rat, human
microarray, western blot pricing
SAB4501211 Anti-RSK1 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, western blot pricing
WH0006195M1 Monoclonal Anti-RPS6KA1 antibody produced in mouse clone 2E3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404334 Monoclonal Anti-RPS6KA1 antibody produced in mouse clone 4E11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5300384 Monoclonal Anti-RPS6KA1 antibody produced in mouse clone 10B1D7A9, ascites fluid human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002953 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002953 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002953 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009097 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009097 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009097 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001006665 Rosetta Predictions human pricing
NM_002953 Rosetta Predictions human pricing
NM_031107 Rosetta Predictions rat pricing
NM_009097 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006665 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070213 predicted 1043
2 SASI_Hs02_00305126 predicted 2184
3 SASI_Hs01_00070216 predicted 888
4 SASI_Hs01_00070217 predicted 724
5 SASI_Hs01_00070218 predicted 1682
6 SASI_Hs01_00070219 predicted 1118
7 SASI_Hs01_00070220 predicted 1900
8 SASI_Hs01_00070221 predicted 2067
9 SASI_Hs02_00305127 predicted 1875
10 SASI_Hs02_00305128 predicted 1065
11 SASI_Hs01_00070214 predicted 417
12 SASI_Hs01_00070215 predicted 1105
13 SASI_Hs01_00070222 predicted 718
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002953 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218369 predicted 1128
2 SASI_Hs02_00334797 predicted 2275
3 SASI_Hs01_00218372 predicted 977
4 SASI_Hs01_00218373 predicted 812
5 SASI_Hs01_00218374 predicted 1769
6 SASI_Hs01_00218375 predicted 1202
7 SASI_Hs01_00218376 predicted 1987
8 SASI_Hs01_00218377 predicted 2151
9 SASI_Hs02_00334798 predicted 1961
10 SASI_Hs02_00334799 predicted 1152
11 SASI_Hs01_00218370 predicted 496
12 SASI_Hs01_00218371 predicted 1194
13 SASI_Hs01_00218378 predicted 807
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031107 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055474 predicted 1842
2 SASI_Rn01_00055475 predicted 1133
3 SASI_Rn01_00055476 predicted 388
4 SASI_Rn01_00055477 predicted 1753
5 SASI_Rn01_00055478 predicted 1132
6 SASI_Rn01_00055479 predicted 1709
7 SASI_Rn01_00055480 predicted 1183
8 SASI_Rn01_00055481 predicted 1864
9 SASI_Rn01_00055482 predicted 1960
10 SASI_Rn01_00055483 predicted 2232
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009097 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315343 predicted 2260
2 SASI_Mm02_00315344 predicted 624
3 SASI_Mm02_00315345 predicted 1782
4 SASI_Mm02_00315346 predicted 1729
5 SASI_Mm02_00315347 predicted 2181
6 SASI_Mm02_00315348 predicted 1204
7 SASI_Mm02_00315349 predicted 1890
8 SASI_Mm02_00315350 predicted 1991
9 SASI_Mm02_00315351 predicted 502
10 SASI_Mm02_00315352 predicted 1095
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002953
VALIDATED
RPS6KA1 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein S6 kinase, 90kDa, polypeptide 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002953.x-337s1c1
Sequence:CCGGCATTTCGAGCTCCTCAAGGTTCTCGAGAACCTTGAGGAGCTCGAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001384    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002953.x-2576s1c1
Sequence:CCGGAGCGATTCACTGTATAAACTTCTCGAGAAGTTTATACAGTGAATCGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010427    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002953.x-2608s1c1
Sequence:CCGGAAAAATGGCATCAACCACCATCTCGAGATGGTGGTTGATGCCATTTTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002953.x-564s1c1
Sequence:CCGGGCTCTATCTCATTCTGGACTTCTCGAGAAGTCCAGAATGAGATAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002953.x-2081s1c1
Sequence:CCGGACACAGTTTCAGAGACAGCCACTCGAGTGGCTGTCTCTGAAACTGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002953.x-963s1c1
Sequence:CCGGGACCATGACACTGATTCTGAACTCGAGTTCAGAATCAGTGTCATGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002953.x-957s1c1
Sequence:CCGGGAAGGAGACCATGACACTGATCTCGAGATCAGTGTCATGGTCTCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039753    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002953.2-2608s1c1
Sequence:CCGGAAAATGGCATCAACCACCATCCTCGAGGATGGTGGTTGATGCCATTTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002953.2-1406s1c1
Sequence:CCGGGCTACGTGGTAAAGGAGACAACTCGAGTTGTCTCCTTTACCACGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A-431
TRC Version: 1 Clone ID:NM_002953.2-1564s1c1
Sequence:CCGGCCCAACATCATCACTCTGAAACTCGAGTTTCAGAGTGATGATGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002953.3-563s1c1
Sequence:CCGGGAGGGCAAGCTCTATCTCATTCTCGAGAATGAGATAGAGCTTGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002953.3-1601s1c1
Sequence:CCGGGATGATGGCAAACACGTGTACCTCGAGGTACACGTGTTTGCCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002953.3-1670s1c1
Sequence:CCGGCGGCAGAAGTTCTTCTCAGAGCTCGAGCTCTGAGAAGAACTTCTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199383    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002953.3-2510s1c1
Sequence:CCGGCTAATGAGGGTGTGAGAAGTGCTCGAGCACTTCTCACACCCTCATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002953
VALIDATED
RPS6KA1 MISSION shRNA shRNA Plasmid DNA
ribosomal protein S6 kinase, 90kDa, polypeptide 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002953.x-337s1c1
Sequence:CCGGCATTTCGAGCTCCTCAAGGTTCTCGAGAACCTTGAGGAGCTCGAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001384    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002953.x-2576s1c1
Sequence:CCGGAGCGATTCACTGTATAAACTTCTCGAGAAGTTTATACAGTGAATCGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010427    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002953.x-2608s1c1
Sequence:CCGGAAAAATGGCATCAACCACCATCTCGAGATGGTGGTTGATGCCATTTTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002953.x-564s1c1
Sequence:CCGGGCTCTATCTCATTCTGGACTTCTCGAGAAGTCCAGAATGAGATAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002953.x-2081s1c1
Sequence:CCGGACACAGTTTCAGAGACAGCCACTCGAGTGGCTGTCTCTGAAACTGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002953.x-963s1c1
Sequence:CCGGGACCATGACACTGATTCTGAACTCGAGTTCAGAATCAGTGTCATGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002953.x-957s1c1
Sequence:CCGGGAAGGAGACCATGACACTGATCTCGAGATCAGTGTCATGGTCTCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039753    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002953.2-2608s1c1
Sequence:CCGGAAAATGGCATCAACCACCATCCTCGAGGATGGTGGTTGATGCCATTTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002953.2-1406s1c1
Sequence:CCGGGCTACGTGGTAAAGGAGACAACTCGAGTTGTCTCCTTTACCACGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A-431
TRC Version: 1 Clone ID:NM_002953.2-1564s1c1
Sequence:CCGGCCCAACATCATCACTCTGAAACTCGAGTTTCAGAGTGATGATGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002953.3-563s1c1
Sequence:CCGGGAGGGCAAGCTCTATCTCATTCTCGAGAATGAGATAGAGCTTGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002953.3-1601s1c1
Sequence:CCGGGATGATGGCAAACACGTGTACCTCGAGGTACACGTGTTTGCCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002953.3-1670s1c1
Sequence:CCGGCGGCAGAAGTTCTTCTCAGAGCTCGAGCTCTGAGAAGAACTTCTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199383    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002953.3-2510s1c1
Sequence:CCGGCTAATGAGGGTGTGAGAAGTGCTCGAGCACTTCTCACACCCTCATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002953
VALIDATED
RPS6KA1 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein S6 kinase, 90kDa, polypeptide 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002953.x-337s1c1
Sequence:CCGGCATTTCGAGCTCCTCAAGGTTCTCGAGAACCTTGAGGAGCTCGAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001384    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002953.x-2576s1c1
Sequence:CCGGAGCGATTCACTGTATAAACTTCTCGAGAAGTTTATACAGTGAATCGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010427    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002953.x-2608s1c1
Sequence:CCGGAAAAATGGCATCAACCACCATCTCGAGATGGTGGTTGATGCCATTTTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002953.x-564s1c1
Sequence:CCGGGCTCTATCTCATTCTGGACTTCTCGAGAAGTCCAGAATGAGATAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002953.x-2081s1c1
Sequence:CCGGACACAGTTTCAGAGACAGCCACTCGAGTGGCTGTCTCTGAAACTGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002953.x-963s1c1
Sequence:CCGGGACCATGACACTGATTCTGAACTCGAGTTCAGAATCAGTGTCATGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002953.x-957s1c1
Sequence:CCGGGAAGGAGACCATGACACTGATCTCGAGATCAGTGTCATGGTCTCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039753    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002953.2-2608s1c1
Sequence:CCGGAAAATGGCATCAACCACCATCCTCGAGGATGGTGGTTGATGCCATTTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002953.2-1406s1c1
Sequence:CCGGGCTACGTGGTAAAGGAGACAACTCGAGTTGTCTCCTTTACCACGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A-431
TRC Version: 1 Clone ID:NM_002953.2-1564s1c1
Sequence:CCGGCCCAACATCATCACTCTGAAACTCGAGTTTCAGAGTGATGATGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002953.3-563s1c1
Sequence:CCGGGAGGGCAAGCTCTATCTCATTCTCGAGAATGAGATAGAGCTTGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002953.3-1601s1c1
Sequence:CCGGGATGATGGCAAACACGTGTACCTCGAGGTACACGTGTTTGCCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002953.3-1670s1c1
Sequence:CCGGCGGCAGAAGTTCTTCTCAGAGCTCGAGCTCTGAGAAGAACTTCTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199383    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002953.3-2510s1c1
Sequence:CCGGCTAATGAGGGTGTGAGAAGTGCTCGAGCACTTCTCACACCCTCATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009097
VALIDATED
RPS6KA1 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein S6 kinase, 90kDa, polypeptide 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009097.1-559s1c1
Sequence:CCGGGCTCTATCTTATTCTGGACTTCTCGAGAAGTCCAGAATAAGATAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009097.1-1053s1c1
Sequence:CCGGCAGAGGAAATTAAGAGACATACTCGAGTATGTCTCTTAATTTCCTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009097.1-1672s1c1
Sequence:CCGGGATCAGCAAGACTGTGGAATACTCGAGTATTCCACAGTCTTGCTGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009097.1-685s1c1
Sequence:CCGGGCACAGCTTGGGCATTATTTACTCGAGTAAATAATGCCCAAGCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009097.4-1409s21c1
Sequence:CCGGCAGTGACGGCTACGTAGTAAACTCGAGTTTACTACGTAGCCGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009097.4-2266s21c1
Sequence:CCGGCTACATACTCTGCTCTCAATACTCGAGTATTGAGAGCAGAGTATGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009097.4-575s21c1
Sequence:CCGGGCTCTATCTTATTCTGGACTTCTCGAGAAGTCCAGAATAAGATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274655    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009097.4-2590s21c1
Sequence:CCGGGGCGTCATCTCCCATGAATTTCTCGAGAAATTCATGGGAGATGACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009097.4-701s21c1
Sequence:CCGGGCACAGCTTGGGCATTATTTACTCGAGTAAATAATGCCCAAGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009097
VALIDATED
RPS6KA1 MISSION shRNA shRNA Plasmid DNA
ribosomal protein S6 kinase, 90kDa, polypeptide 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009097.1-559s1c1
Sequence:CCGGGCTCTATCTTATTCTGGACTTCTCGAGAAGTCCAGAATAAGATAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009097.1-1053s1c1
Sequence:CCGGCAGAGGAAATTAAGAGACATACTCGAGTATGTCTCTTAATTTCCTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009097.1-1672s1c1
Sequence:CCGGGATCAGCAAGACTGTGGAATACTCGAGTATTCCACAGTCTTGCTGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009097.1-685s1c1
Sequence:CCGGGCACAGCTTGGGCATTATTTACTCGAGTAAATAATGCCCAAGCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009097.4-1409s21c1
Sequence:CCGGCAGTGACGGCTACGTAGTAAACTCGAGTTTACTACGTAGCCGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009097.4-2266s21c1
Sequence:CCGGCTACATACTCTGCTCTCAATACTCGAGTATTGAGAGCAGAGTATGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009097.4-575s21c1
Sequence:CCGGGCTCTATCTTATTCTGGACTTCTCGAGAAGTCCAGAATAAGATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274655    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009097.4-2590s21c1
Sequence:CCGGGGCGTCATCTCCCATGAATTTCTCGAGAAATTCATGGGAGATGACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009097.4-701s21c1
Sequence:CCGGGCACAGCTTGGGCATTATTTACTCGAGTAAATAATGCCCAAGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009097
VALIDATED
RPS6KA1 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein S6 kinase, 90kDa, polypeptide 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009097.1-559s1c1
Sequence:CCGGGCTCTATCTTATTCTGGACTTCTCGAGAAGTCCAGAATAAGATAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009097.1-1053s1c1
Sequence:CCGGCAGAGGAAATTAAGAGACATACTCGAGTATGTCTCTTAATTTCCTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009097.1-1672s1c1
Sequence:CCGGGATCAGCAAGACTGTGGAATACTCGAGTATTCCACAGTCTTGCTGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009097.1-685s1c1
Sequence:CCGGGCACAGCTTGGGCATTATTTACTCGAGTAAATAATGCCCAAGCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009097.4-1409s21c1
Sequence:CCGGCAGTGACGGCTACGTAGTAAACTCGAGTTTACTACGTAGCCGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009097.4-2266s21c1
Sequence:CCGGCTACATACTCTGCTCTCAATACTCGAGTATTGAGAGCAGAGTATGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009097.4-575s21c1
Sequence:CCGGGCTCTATCTTATTCTGGACTTCTCGAGAAGTCCAGAATAAGATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274655    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009097.4-2590s21c1
Sequence:CCGGGGCGTCATCTCCCATGAATTTCTCGAGAAATTCATGGGAGATGACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009097.4-701s21c1
Sequence:CCGGGCACAGCTTGGGCATTATTTACTCGAGTAAATAATGCCCAAGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks