EMAIL THIS PAGE TO A FRIEND

RPS6KA4

ribosomal protein S6 kinase, 90kDa, polypeptide 4

Synonyms: MSK2 RSK-B
UniProtKB ID: O75676, A8K7Z8, O75585, Q53ES8
Gene ID:
Human(8986) Summary: This gene encodes a member of the RSK (ribosomal S6 kinase) family of serine/threonine kinases. This kinase contains 2 non-identical kinase catalytic domains and phosphorylates various substrates, including CREB1 and c-fos. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
Mouse(56613) ribosomal protein S6 kinase, polypeptide 4
Rat(361715) ribosomal protein S6 kinase, polypeptide 4
Zebrafish(561959) ribosomal protein S6 kinase, polypeptide 4
domestic cat(101093713) ribosomal protein S6 kinase, 90kDa, polypeptide 4
dog(612105) ribosomal protein S6 kinase, 90kDa, polypeptide 4
naked mole-rat(101720436) ribosomal protein S6 kinase, 90kDa, polypeptide 4
domestic guinea pig(100716989) ribosomal protein S6 kinase, 90kDa, polypeptide 4
cow(523746) ribosomal protein S6 kinase, 90kDa, polypeptide 4
sheep(101117122) ribosomal protein S6 kinase, 90kDa, polypeptide 4
128 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003942 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003942 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003942 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019924 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019924 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019924 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001006944 Rosetta Predictions human pricing
NM_003942 siRNAs that have been validated in the lab human pricing
NM_001108517 Rosetta Predictions rat pricing
NM_019924 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006944 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011868 predicted 533
2 SASI_Hs01_00011869 predicted 664
3 SASI_Hs01_00011870 predicted 1850
4 SASI_Hs01_00011871 predicted 615
5 SASI_Hs01_00011872 predicted 591
6 SASI_Hs01_00011873 predicted 1047
7 SASI_Hs01_00011874 predicted 1584
8 SASI_Hs01_00011875 predicted 751
9 SASI_Hs01_00011876 predicted 699
10 SASI_Hs01_00011877 predicted 899
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003942 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233332 validated 662
2 SASI_Hs01_00233331 predicted 539
3 SASI_Hs01_00233333 predicted 1867
4 SASI_Hs01_00233334 predicted 606
5 SASI_Hs01_00233335 predicted 599
6 SASI_Hs01_00233336 predicted 1044
7 SASI_Hs01_00233337 predicted 1597
8 SASI_Hs01_00233338 predicted 756
9 SASI_Hs01_00233339 predicted 695
10 SASI_Hs01_00233340 predicted 898
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108517 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239429 predicted 500
2 SASI_Rn02_00239430 predicted 1106
3 SASI_Rn02_00239431 predicted 2326
4 SASI_Rn02_00239432 predicted 1875
5 SASI_Rn02_00239433 predicted 546
6 SASI_Rn02_00239434 predicted 1667
7 SASI_Rn02_00239435 predicted 408
8 SASI_Rn02_00239436 predicted 660
9 SASI_Rn02_00239437 predicted 649
10 SASI_Rn02_00239438 predicted 2122
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019924 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179331 predicted 1448
2 SASI_Mm01_00179332 predicted 1486
3 SASI_Mm01_00179333 predicted 230
4 SASI_Mm01_00179334 predicted 547
5 SASI_Mm01_00179335 predicted 404
6 SASI_Mm01_00179336 predicted 2357
7 SASI_Mm01_00179337 predicted 661
8 SASI_Mm01_00179338 predicted 1911
9 SASI_Mm01_00179339 predicted 566
10 SASI_Mm01_00179340 predicted 1808
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003942
VALIDATED
RPS6KA4 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein S6 kinase, 90kDa, polypeptide 4
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003942.2-170s21c1
Sequence:CCGGCGTGGAGAACTTCGAGCTGCTCTCGAGAGCAGCTCGAAGTTCTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003942.2-539s21c1
Sequence:CCGGGCACAAGCTCGGCATCATTTACTCGAGTAAATGATGCCGAGCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003942.2-2841s21c1
Sequence:CCGGCGTCCACCAAAGACCCGTGTTCTCGAGAACACGGGTCTTTGGTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003942.2-2003s21c1
Sequence:CCGGGCAGGGTGTATCCGAGGAAGCCTCGAGGCTTCCTCGGATACACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003942.2-2193s1c1
Sequence:CCGGGCCACCTTCATGGCATTCAACCTCGAGGTTGAATGCCATGAAGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003942.2-2003s1c1
Sequence:CCGGGCAGGGTGTATCCGAGGAAGCCTCGAGGCTTCCTCGGATACACCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195726    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003942.2-2909s1c1
Sequence:CCGGCCTCACTTTATGTCATCTGCTCTCGAGAGCAGATGACATAAAGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003942.2-170s1c1
Sequence:CCGGCGTGGAGAACTTCGAGCTGCTCTCGAGAGCAGCTCGAAGTTCTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003942.2-2841s1c1
Sequence:CCGGCGTCCACCAAAGACCCGTGTTCTCGAGAACACGGGTCTTTGGTGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003942.1-521s1c1
Sequence:CCGGGCACAAGCTCGGCATCATTTACTCGAGTAAATGATGCCGAGCTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003942.1-682s1c1
Sequence:CCGGCCGAAATCATCCGTAGCAAGACTCGAGTCTTGCTACGGATGATTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021514    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003942.1-2516s1c1
Sequence:CCGGCCAGACAGAGCAGAAGTATTTCTCGAGAAATACTTCTGCTCTGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003942
VALIDATED
RPS6KA4 MISSION shRNA shRNA Plasmid DNA
ribosomal protein S6 kinase, 90kDa, polypeptide 4
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003942.2-170s21c1
Sequence:CCGGCGTGGAGAACTTCGAGCTGCTCTCGAGAGCAGCTCGAAGTTCTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003942.2-539s21c1
Sequence:CCGGGCACAAGCTCGGCATCATTTACTCGAGTAAATGATGCCGAGCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003942.2-2841s21c1
Sequence:CCGGCGTCCACCAAAGACCCGTGTTCTCGAGAACACGGGTCTTTGGTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003942.2-2003s21c1
Sequence:CCGGGCAGGGTGTATCCGAGGAAGCCTCGAGGCTTCCTCGGATACACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003942.2-2193s1c1
Sequence:CCGGGCCACCTTCATGGCATTCAACCTCGAGGTTGAATGCCATGAAGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003942.2-2003s1c1
Sequence:CCGGGCAGGGTGTATCCGAGGAAGCCTCGAGGCTTCCTCGGATACACCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195726    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003942.2-2909s1c1
Sequence:CCGGCCTCACTTTATGTCATCTGCTCTCGAGAGCAGATGACATAAAGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003942.2-170s1c1
Sequence:CCGGCGTGGAGAACTTCGAGCTGCTCTCGAGAGCAGCTCGAAGTTCTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003942.2-2841s1c1
Sequence:CCGGCGTCCACCAAAGACCCGTGTTCTCGAGAACACGGGTCTTTGGTGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003942.1-521s1c1
Sequence:CCGGGCACAAGCTCGGCATCATTTACTCGAGTAAATGATGCCGAGCTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003942.1-682s1c1
Sequence:CCGGCCGAAATCATCCGTAGCAAGACTCGAGTCTTGCTACGGATGATTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021514    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003942.1-2516s1c1
Sequence:CCGGCCAGACAGAGCAGAAGTATTTCTCGAGAAATACTTCTGCTCTGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003942
VALIDATED
RPS6KA4 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein S6 kinase, 90kDa, polypeptide 4
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003942.2-170s21c1
Sequence:CCGGCGTGGAGAACTTCGAGCTGCTCTCGAGAGCAGCTCGAAGTTCTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003942.2-539s21c1
Sequence:CCGGGCACAAGCTCGGCATCATTTACTCGAGTAAATGATGCCGAGCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003942.2-2841s21c1
Sequence:CCGGCGTCCACCAAAGACCCGTGTTCTCGAGAACACGGGTCTTTGGTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003942.2-2003s21c1
Sequence:CCGGGCAGGGTGTATCCGAGGAAGCCTCGAGGCTTCCTCGGATACACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003942.2-2193s1c1
Sequence:CCGGGCCACCTTCATGGCATTCAACCTCGAGGTTGAATGCCATGAAGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003942.2-2003s1c1
Sequence:CCGGGCAGGGTGTATCCGAGGAAGCCTCGAGGCTTCCTCGGATACACCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195726    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003942.2-2909s1c1
Sequence:CCGGCCTCACTTTATGTCATCTGCTCTCGAGAGCAGATGACATAAAGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003942.2-170s1c1
Sequence:CCGGCGTGGAGAACTTCGAGCTGCTCTCGAGAGCAGCTCGAAGTTCTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003942.2-2841s1c1
Sequence:CCGGCGTCCACCAAAGACCCGTGTTCTCGAGAACACGGGTCTTTGGTGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003942.1-521s1c1
Sequence:CCGGGCACAAGCTCGGCATCATTTACTCGAGTAAATGATGCCGAGCTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003942.1-682s1c1
Sequence:CCGGCCGAAATCATCCGTAGCAAGACTCGAGTCTTGCTACGGATGATTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021514    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003942.1-2516s1c1
Sequence:CCGGCCAGACAGAGCAGAAGTATTTCTCGAGAAATACTTCTGCTCTGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019924
VALIDATED
RPS6KA4 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein S6 kinase, 90kDa, polypeptide 4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019924.1-276s21c1
Sequence:CCGGGCGCGAAGACACAGGAGCATACTCGAGTATGCTCCTGTGTCTTCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019924.1-1516s21c1
Sequence:CCGGCGGAGAGCTATTGGAACACATCTCGAGATGTGTTCCAATAGCTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019924.1-415s21c1
Sequence:CCGGTGAGATGTTCACTCACCTCTACTCGAGTAGAGGTGAGTGAACATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019924.1-2203s21c1
Sequence:CCGGCTTTCTCAAGAGTGTAGAGAACTCGAGTTCTCTACACTCTTGAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019924.1-1516s1c1
Sequence:CCGGCGGAGAGCTATTGGAACACATCTCGAGATGTGTTCCAATAGCTCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019924.1-2203s1c1
Sequence:CCGGCTTTCTCAAGAGTGTAGAGAACTCGAGTTCTCTACACTCTTGAGAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019924.1-1108s1c1
Sequence:CCGGCCCTCGGATCTTTCAGGGATACTCGAGTATCCCTGAAAGATCCGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019924.1-415s1c1
Sequence:CCGGTGAGATGTTCACTCACCTCTACTCGAGTAGAGGTGAGTGAACATCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019924
VALIDATED
RPS6KA4 MISSION shRNA shRNA Plasmid DNA
ribosomal protein S6 kinase, 90kDa, polypeptide 4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019924.1-276s21c1
Sequence:CCGGGCGCGAAGACACAGGAGCATACTCGAGTATGCTCCTGTGTCTTCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019924.1-1516s21c1
Sequence:CCGGCGGAGAGCTATTGGAACACATCTCGAGATGTGTTCCAATAGCTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019924.1-415s21c1
Sequence:CCGGTGAGATGTTCACTCACCTCTACTCGAGTAGAGGTGAGTGAACATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019924.1-2203s21c1
Sequence:CCGGCTTTCTCAAGAGTGTAGAGAACTCGAGTTCTCTACACTCTTGAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019924.1-1516s1c1
Sequence:CCGGCGGAGAGCTATTGGAACACATCTCGAGATGTGTTCCAATAGCTCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019924.1-2203s1c1
Sequence:CCGGCTTTCTCAAGAGTGTAGAGAACTCGAGTTCTCTACACTCTTGAGAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019924.1-1108s1c1
Sequence:CCGGCCCTCGGATCTTTCAGGGATACTCGAGTATCCCTGAAAGATCCGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019924.1-415s1c1
Sequence:CCGGTGAGATGTTCACTCACCTCTACTCGAGTAGAGGTGAGTGAACATCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019924
VALIDATED
RPS6KA4 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein S6 kinase, 90kDa, polypeptide 4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019924.1-276s21c1
Sequence:CCGGGCGCGAAGACACAGGAGCATACTCGAGTATGCTCCTGTGTCTTCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019924.1-1516s21c1
Sequence:CCGGCGGAGAGCTATTGGAACACATCTCGAGATGTGTTCCAATAGCTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019924.1-415s21c1
Sequence:CCGGTGAGATGTTCACTCACCTCTACTCGAGTAGAGGTGAGTGAACATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019924.1-2203s21c1
Sequence:CCGGCTTTCTCAAGAGTGTAGAGAACTCGAGTTCTCTACACTCTTGAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019924.1-1516s1c1
Sequence:CCGGCGGAGAGCTATTGGAACACATCTCGAGATGTGTTCCAATAGCTCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019924.1-2203s1c1
Sequence:CCGGCTTTCTCAAGAGTGTAGAGAACTCGAGTTCTCTACACTCTTGAGAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019924.1-1108s1c1
Sequence:CCGGCCCTCGGATCTTTCAGGGATACTCGAGTATCCCTGAAAGATCCGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019924.1-415s1c1
Sequence:CCGGTGAGATGTTCACTCACCTCTACTCGAGTAGAGGTGAGTGAACATCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks