EMAIL THIS PAGE TO A FRIEND

RPS6KA6

ribosomal protein S6 kinase, 90kDa, polypeptide 6

Synonyms: PP90RSK4 RSK4
UniProtKB ID: Q9UK32, B2R854, Q6FHX2, Q8WX28, Q9H4S6
Gene ID:
Human(27330) Summary: This gene encodes a member of ribosomal S6 kinase family, serine-threonine protein kinases which are regulated by growth factors. The encoded protein may be distinct from other members of this family, however, as studies suggest it is not growth factor dependent and may not participate in the same signaling pathways. [provided by RefSeq, Jan 2010]
Mouse(67071) ribosomal protein S6 kinase polypeptide 6
Rat(317203) ribosomal protein S6 kinase polypeptide 6
chicken(422273) ribosomal protein S6 kinase, 90kDa, polypeptide 6
domestic cat(101094163) ribosomal protein S6 kinase, 90kDa, polypeptide 6
dog(491989) ribosomal protein S6 kinase, 90kDa, polypeptide 6
Domestic Rabbit(100349186) ribosomal protein S6 kinase, 90kDa, polypeptide 6
naked mole-rat(101703020) ribosomal protein S6 kinase, 90kDa, polypeptide 6
domestic guinea pig(100731385) ribosomal protein S6 kinase, 90kDa, polypeptide 6
cow(526227) ribosomal protein S6 kinase, 90kDa, polypeptide 6
sheep(101121915) ribosomal protein S6 kinase, 90kDa, polypeptide 6
102 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302355 ANTI-MOUSE RPS6KA6 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
SAB4504643 Anti-phospho-RSK1/2/3/4 (pSer221/227/218/232) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
R9155 Anti-RPS6KA6 (61-75) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
R9280 Anti-RPS6KA6 (686-700) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
HPA002852 Anti-RPS6KA6 antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
HPA003904 Anti-RPS6KA6 antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1306407 ANTI-RSK4(N-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution primate, human
immunohistochemistry, western blot pricing
SAB4501212 Anti-S6K-α6, C-Terminal antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
WH0027330M2 Monoclonal Anti-RPS6KA6 antibody produced in mouse clone 6F2, purified immunoglobulin, buffered aqueous solution rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB1409122 Monoclonal Anti-RPS6KA6 antibody produced in mouse clone 3A1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409123 Monoclonal Anti-RPS6KA6 antibody produced in mouse clone 8D2, purified immunoglobulin, buffered aqueous solution rat, human
ELISA, western blot pricing
SAB1409124 Monoclonal Anti-RPS6KA6 antibody produced in mouse clone 3G12, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409125 Monoclonal Anti-RPS6KA6 antibody produced in mouse clone 3E2, ascites fluid, solution human, rat
ELISA, western blot pricing
SAB1409126 Monoclonal Anti-RPS6KA6 antibody produced in mouse clone 3G12, ascites fluid, solution human
ELISA, western blot pricing
SAB1405041 Monoclonal Anti-RPS6KA6, (C-terminal) antibody produced in mouse clone 8H5, purified immunoglobulin, buffered aqueous solution rat, human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014496 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014496 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014496 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025949 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025949 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025949 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014496 Rosetta Predictions human pricing
XM_001061436 Rosetta Predictions rat pricing
XM_228473 Rosetta Predictions rat pricing
NM_025949 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014496 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206364 predicted 840
2 SASI_Hs01_00206365 predicted 2205
3 SASI_Hs02_00345747 predicted 2184
4 SASI_Hs01_00206366 predicted 1729
5 SASI_Hs01_00206367 predicted 1576
6 SASI_Hs01_00206369 predicted 1422
7 SASI_Hs01_00206370 predicted 1660
8 SASI_Hs01_00206371 predicted 2155
9 SASI_Hs01_00206372 predicted 378
10 SASI_Hs01_00206373 predicted 1097
11 SASI_Hs01_00206368 predicted 1541
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061436 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00300084 predicted 1557
2 SASI_Rn02_00300085 predicted 514
3 SASI_Rn02_00300086 predicted 1912
4 SASI_Rn02_00300087 predicted 523
5 SASI_Rn02_00300088 predicted 1857
6 SASI_Rn02_00300089 predicted 1479
7 SASI_Rn02_00300090 predicted 884
8 SASI_Rn02_00300091 predicted 1121
9 SASI_Rn02_00300092 predicted 2241
10 SASI_Rn02_00300093 predicted 867
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228473 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385132 predicted 1554
2 SASI_Rn02_00385133 predicted 1831
3 SASI_Rn02_00385134 predicted 1183
4 SASI_Rn02_00385135 predicted 1910
5 SASI_Rn02_00385136 predicted 1855
6 SASI_Rn02_00385137 predicted 1481
7 SASI_Rn02_00385138 predicted 2003
8 SASI_Rn02_00385139 predicted 1485
9 SASI_Rn02_00385140 predicted 2280
10 SASI_Rn02_00385141 predicted 1117
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025949 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329345 predicted 703
2 SASI_Mm01_00156673 predicted 2044
3 SASI_Mm01_00156675 predicted 652
4 SASI_Mm01_00156676 predicted 1971
5 SASI_Mm01_00156677 predicted 535
6 SASI_Mm01_00156678 predicted 1997
7 SASI_Mm01_00156679 predicted 1048
8 SASI_Mm01_00156680 predicted 932
9 SASI_Mm01_00156681 predicted 663
10 SASI_Mm01_00156682 predicted 2776
11 SASI_Mm01_00156674 predicted 1817
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014496
VALIDATED
RPS6KA6 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein S6 kinase, 90kDa, polypeptide 6
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014496.3-2426s21c1
Sequence:GTACCGGACCATTCACAGGTCCACAATACTCGAGTATTGTGGACCTGTGAATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014496.2-1585s21c1
Sequence:CCGGGAGAGTTACTTGACCGTATTCCTCGAGGAATACGGTCAAGTAACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014496.2-1555s21c1
Sequence:CCGGTTTACCTTGTTACGGATTTAACTCGAGTTAAATCCGTAACAAGGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014496.2-1968s21c1
Sequence:CCGGGAAGAGATACTGCTGCGTATACTCGAGTATACGCAGCAGTATCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014496.2-2392s21c1
Sequence:CCGGCATCGTTGTCTGCTAAATTACCTCGAGGTAATTTAGCAGACAACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014496.1-1752s1c1
Sequence:CCGGGCAGATTCAATCAGGATATGTCTCGAGACATATCCTGATTGAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014496.1-1971s1c1
Sequence:CCGGGAAGAGATACTGCTGCGTATACTCGAGTATACGCAGCAGTATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014496.1-1884s1c1
Sequence:CCGGGCTTGTGATATCTGGAGTTTACTCGAGTAAACTCCAGATATCACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196585    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014496.1-2481s1c1
Sequence:CCGGGTCCACAATATTCATACTATGCTCGAGCATAGTATGAATATTGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014496.1-1588s1c1
Sequence:CCGGGAGAGTTACTTGACCGTATTCCTCGAGGAATACGGTCAAGTAACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014496.x-1353s1c1
Sequence:CCGGGTATATGAATTGAAGGAGGATCTCGAGATCCTCCTTCAATTCATATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002263    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014496.x-2507s1c1
Sequence:CCGGGCAGTAGTGTTCAAGTGTTTACTCGAGTAAACACTTGAACACTACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014496.x-383s1c1
Sequence:CCGGCTATGCAATGAAGGTGTTAAACTCGAGTTTAACACCTTCATTGCATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014496.x-2015s1c1
Sequence:CCGGTGGTGGAAACTGGGACAATATCTCGAGATATTGTCCCAGTTTCCACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014496.x-229s1c1
Sequence:CCGGGAGTTGTTAAAGAAATCCCTACTCGAGTAGGGATTTCTTTAACAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014496
VALIDATED
RPS6KA6 MISSION shRNA shRNA Plasmid DNA
ribosomal protein S6 kinase, 90kDa, polypeptide 6
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014496.3-2426s21c1
Sequence:GTACCGGACCATTCACAGGTCCACAATACTCGAGTATTGTGGACCTGTGAATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014496.2-1585s21c1
Sequence:CCGGGAGAGTTACTTGACCGTATTCCTCGAGGAATACGGTCAAGTAACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014496.2-1555s21c1
Sequence:CCGGTTTACCTTGTTACGGATTTAACTCGAGTTAAATCCGTAACAAGGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014496.2-1968s21c1
Sequence:CCGGGAAGAGATACTGCTGCGTATACTCGAGTATACGCAGCAGTATCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014496.2-2392s21c1
Sequence:CCGGCATCGTTGTCTGCTAAATTACCTCGAGGTAATTTAGCAGACAACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014496.1-1752s1c1
Sequence:CCGGGCAGATTCAATCAGGATATGTCTCGAGACATATCCTGATTGAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014496.1-1971s1c1
Sequence:CCGGGAAGAGATACTGCTGCGTATACTCGAGTATACGCAGCAGTATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014496.1-1884s1c1
Sequence:CCGGGCTTGTGATATCTGGAGTTTACTCGAGTAAACTCCAGATATCACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196585    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014496.1-2481s1c1
Sequence:CCGGGTCCACAATATTCATACTATGCTCGAGCATAGTATGAATATTGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014496.1-1588s1c1
Sequence:CCGGGAGAGTTACTTGACCGTATTCCTCGAGGAATACGGTCAAGTAACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014496.x-1353s1c1
Sequence:CCGGGTATATGAATTGAAGGAGGATCTCGAGATCCTCCTTCAATTCATATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002263    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014496.x-2507s1c1
Sequence:CCGGGCAGTAGTGTTCAAGTGTTTACTCGAGTAAACACTTGAACACTACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014496.x-383s1c1
Sequence:CCGGCTATGCAATGAAGGTGTTAAACTCGAGTTTAACACCTTCATTGCATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014496.x-2015s1c1
Sequence:CCGGTGGTGGAAACTGGGACAATATCTCGAGATATTGTCCCAGTTTCCACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014496.x-229s1c1
Sequence:CCGGGAGTTGTTAAAGAAATCCCTACTCGAGTAGGGATTTCTTTAACAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014496
VALIDATED
RPS6KA6 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein S6 kinase, 90kDa, polypeptide 6
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014496.3-2426s21c1
Sequence:GTACCGGACCATTCACAGGTCCACAATACTCGAGTATTGTGGACCTGTGAATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014496.2-1585s21c1
Sequence:CCGGGAGAGTTACTTGACCGTATTCCTCGAGGAATACGGTCAAGTAACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014496.2-1555s21c1
Sequence:CCGGTTTACCTTGTTACGGATTTAACTCGAGTTAAATCCGTAACAAGGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014496.2-1968s21c1
Sequence:CCGGGAAGAGATACTGCTGCGTATACTCGAGTATACGCAGCAGTATCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_014496.2-2392s21c1
Sequence:CCGGCATCGTTGTCTGCTAAATTACCTCGAGGTAATTTAGCAGACAACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014496.1-1752s1c1
Sequence:CCGGGCAGATTCAATCAGGATATGTCTCGAGACATATCCTGATTGAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014496.1-1971s1c1
Sequence:CCGGGAAGAGATACTGCTGCGTATACTCGAGTATACGCAGCAGTATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014496.1-1884s1c1
Sequence:CCGGGCTTGTGATATCTGGAGTTTACTCGAGTAAACTCCAGATATCACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196585    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014496.1-2481s1c1
Sequence:CCGGGTCCACAATATTCATACTATGCTCGAGCATAGTATGAATATTGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014496.1-1588s1c1
Sequence:CCGGGAGAGTTACTTGACCGTATTCCTCGAGGAATACGGTCAAGTAACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014496.x-1353s1c1
Sequence:CCGGGTATATGAATTGAAGGAGGATCTCGAGATCCTCCTTCAATTCATATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002263    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014496.x-2507s1c1
Sequence:CCGGGCAGTAGTGTTCAAGTGTTTACTCGAGTAAACACTTGAACACTACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014496.x-383s1c1
Sequence:CCGGCTATGCAATGAAGGTGTTAAACTCGAGTTTAACACCTTCATTGCATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014496.x-2015s1c1
Sequence:CCGGTGGTGGAAACTGGGACAATATCTCGAGATATTGTCCCAGTTTCCACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014496.x-229s1c1
Sequence:CCGGGAGTTGTTAAAGAAATCCCTACTCGAGTAGGGATTTCTTTAACAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025949
RPS6KA6 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein S6 kinase, 90kDa, polypeptide 6
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025949.2-1384s21c1
Sequence:CCGGCTGAAGCACAAAGTCTATTAACTCGAGTTAATAGACTTTGTGCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025949.2-2488s21c1
Sequence:CCGGTGGACCCACATCAGCGTTATACTCGAGTATAACGCTGATGTGGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025949.2-2117s21c1
Sequence:CCGGTGATCTTAAGCCCAGTAATATCTCGAGATATTACTGGGCTTAAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025949.1-466s1c1
Sequence:CCGGCGCACAGTTTGACTTGCTCAACTCGAGTTGAGCAAGTCAAACTGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025949.1-2133s1c1
Sequence:CCGGCCAATGATACTCCTGAGGAAACTCGAGTTTCCTCAGGAGTATCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025949.1-422s1c1
Sequence:CCGGCCTATTACACAGCATGTTAAACTCGAGTTTAACATGCTGTGTAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025949.1-2060s1c1
Sequence:CCGGGCCTGTGATATTTGGAGCTTACTCGAGTAAGCTCCAAATATCACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025949.1-1430s1c1
Sequence:CCGGGCGACTTCTATTGCCGAAGAACTCGAGTTCTTCGGCAATAGAAGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025949
RPS6KA6 MISSION shRNA shRNA Plasmid DNA
ribosomal protein S6 kinase, 90kDa, polypeptide 6
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025949.2-1384s21c1
Sequence:CCGGCTGAAGCACAAAGTCTATTAACTCGAGTTAATAGACTTTGTGCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025949.2-2488s21c1
Sequence:CCGGTGGACCCACATCAGCGTTATACTCGAGTATAACGCTGATGTGGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025949.2-2117s21c1
Sequence:CCGGTGATCTTAAGCCCAGTAATATCTCGAGATATTACTGGGCTTAAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025949.1-466s1c1
Sequence:CCGGCGCACAGTTTGACTTGCTCAACTCGAGTTGAGCAAGTCAAACTGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025949.1-2133s1c1
Sequence:CCGGCCAATGATACTCCTGAGGAAACTCGAGTTTCCTCAGGAGTATCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025949.1-422s1c1
Sequence:CCGGCCTATTACACAGCATGTTAAACTCGAGTTTAACATGCTGTGTAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025949.1-2060s1c1
Sequence:CCGGGCCTGTGATATTTGGAGCTTACTCGAGTAAGCTCCAAATATCACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025949.1-1430s1c1
Sequence:CCGGGCGACTTCTATTGCCGAAGAACTCGAGTTCTTCGGCAATAGAAGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025949
RPS6KA6 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein S6 kinase, 90kDa, polypeptide 6
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025949.2-1384s21c1
Sequence:CCGGCTGAAGCACAAAGTCTATTAACTCGAGTTAATAGACTTTGTGCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025949.2-2488s21c1
Sequence:CCGGTGGACCCACATCAGCGTTATACTCGAGTATAACGCTGATGTGGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025949.2-2117s21c1
Sequence:CCGGTGATCTTAAGCCCAGTAATATCTCGAGATATTACTGGGCTTAAGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025949.1-466s1c1
Sequence:CCGGCGCACAGTTTGACTTGCTCAACTCGAGTTGAGCAAGTCAAACTGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025949.1-2133s1c1
Sequence:CCGGCCAATGATACTCCTGAGGAAACTCGAGTTTCCTCAGGAGTATCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025949.1-422s1c1
Sequence:CCGGCCTATTACACAGCATGTTAAACTCGAGTTTAACATGCTGTGTAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025949.1-2060s1c1
Sequence:CCGGGCCTGTGATATTTGGAGCTTACTCGAGTAAGCTCCAAATATCACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025949.1-1430s1c1
Sequence:CCGGGCGACTTCTATTGCCGAAGAACTCGAGTTCTTCGGCAATAGAAGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks