EMAIL THIS PAGE TO A FRIEND

RPS8

ribosomal protein S8

Synonyms: S8
UniProtKB ID: P62241, P09058, Q6IRL7
Gene ID:
Human(6202) Summary: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S8E family of ribosomal proteins. It is located in the cytoplasm. Increased expression of this gene in colorectal tumors and colon polyps compared to matched normal colonic mucosa has been observed. This gene is co-transcribed with the small nucleolar RNA genes U38A, U38B, U39, and U40, which are located in its fourth, fifth, first, and second introns, respectively. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Mouse(20116) ribosomal protein S8
Rat(65136) ribosomal protein S8
fruit fly(43532) Ribosomal protein S8
domestic cat(101088094) ribosomal protein S8
dog(475381) ribosomal protein S8
chicken(424584) ribosomal protein S8
Thale Cress(844724) 30S ribosomal protein S8
cow(404140) ribosomal protein S8
sheep(101117800) ribosomal protein S8
naked mole-rat(101701288) ribosomal protein S8
domestic guinea pig(100722205) ribosomal protein S8
32 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009098 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009098 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009098 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012 Rosetta Predictions human pricing
NM_031706 Rosetta Predictions rat pricing
NM_009098 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150642 predicted 219
2 SASI_Hs01_00150643 predicted 224
3 SASI_Hs01_00150644 predicted 629
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031706 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065074 predicted 227
2 SASI_Rn02_00265064 predicted 302
3 SASI_Rn01_00065073 predicted 347
4 SASI_Rn01_00065075 predicted 351
5 SASI_Rn01_00065076 predicted 356
6 SASI_Rn01_00065077 predicted 650
7 SASI_Rn01_00065078 predicted 658
8 SASI_Rn01_00065079 predicted 631
9 SASI_Rn01_00065080 predicted 148
10 SASI_Rn01_00065081 predicted 640
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009098 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096282 predicted 691
2 SASI_Mm01_00096283 predicted 340
3 SASI_Mm01_00096284 predicted 689
4 SASI_Mm01_00096285 predicted 687
5 SASI_Mm01_00096286 predicted 698
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012
VALIDATED
RPS8 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein S8
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000306743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012.1-412s21c1
Sequence:CCGGCTCCTGAGGAAGAAGAGATTTCTCGAGAAATCTCTTCTTCCTCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012.1-276s21c1
Sequence:CCGGGCATCTAATAACGAGCTGGTTCTCGAGAACCAGCTCGTTATTAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012.1-188s21c1
Sequence:CCGGCCGTGCCCTGAGGTTGGACGTCTCGAGACGTCCAACCTCAGGGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012.1-226s21c1
Sequence:CCGGGCTCAGAGTGTTGTACTCGTACTCGAGTACGAGTACAACACTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012.1-226s1c1
Sequence:CCGGGCTCAGAGTGTTGTACTCGTACTCGAGTACGAGTACAACACTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_001012.1-188s1c1
Sequence:CCGGCCGTGCCCTGAGGTTGGACGTCTCGAGACGTCCAACCTCAGGGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012.1-412s1c1
Sequence:CCGGCTCCTGAGGAAGAAGAGATTTCTCGAGAAATCTCTTCTTCCTCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012.1-276s1c1
Sequence:CCGGGCATCTAATAACGAGCTGGTTCTCGAGAACCAGCTCGTTATTAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012
VALIDATED
RPS8 MISSION shRNA shRNA Plasmid DNA
ribosomal protein S8
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000306743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012.1-412s21c1
Sequence:CCGGCTCCTGAGGAAGAAGAGATTTCTCGAGAAATCTCTTCTTCCTCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012.1-276s21c1
Sequence:CCGGGCATCTAATAACGAGCTGGTTCTCGAGAACCAGCTCGTTATTAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012.1-188s21c1
Sequence:CCGGCCGTGCCCTGAGGTTGGACGTCTCGAGACGTCCAACCTCAGGGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012.1-226s21c1
Sequence:CCGGGCTCAGAGTGTTGTACTCGTACTCGAGTACGAGTACAACACTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012.1-226s1c1
Sequence:CCGGGCTCAGAGTGTTGTACTCGTACTCGAGTACGAGTACAACACTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_001012.1-188s1c1
Sequence:CCGGCCGTGCCCTGAGGTTGGACGTCTCGAGACGTCCAACCTCAGGGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012.1-412s1c1
Sequence:CCGGCTCCTGAGGAAGAAGAGATTTCTCGAGAAATCTCTTCTTCCTCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012.1-276s1c1
Sequence:CCGGGCATCTAATAACGAGCTGGTTCTCGAGAACCAGCTCGTTATTAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012
VALIDATED
RPS8 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein S8
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000306743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012.1-412s21c1
Sequence:CCGGCTCCTGAGGAAGAAGAGATTTCTCGAGAAATCTCTTCTTCCTCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012.1-276s21c1
Sequence:CCGGGCATCTAATAACGAGCTGGTTCTCGAGAACCAGCTCGTTATTAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012.1-188s21c1
Sequence:CCGGCCGTGCCCTGAGGTTGGACGTCTCGAGACGTCCAACCTCAGGGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012.1-226s21c1
Sequence:CCGGGCTCAGAGTGTTGTACTCGTACTCGAGTACGAGTACAACACTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012.1-226s1c1
Sequence:CCGGGCTCAGAGTGTTGTACTCGTACTCGAGTACGAGTACAACACTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_001012.1-188s1c1
Sequence:CCGGCCGTGCCCTGAGGTTGGACGTCTCGAGACGTCCAACCTCAGGGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012.1-412s1c1
Sequence:CCGGCTCCTGAGGAAGAAGAGATTTCTCGAGAAATCTCTTCTTCCTCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012.1-276s1c1
Sequence:CCGGGCATCTAATAACGAGCTGGTTCTCGAGAACCAGCTCGTTATTAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009098
RPS8 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein S8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009098.2-362s1c1
Sequence:CCGGGAAGAACTGCATCGTGCTTATCTCGAGATAAGCACGATGCAGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009098.2-165s1c1
Sequence:CCGGCCCGCTGCCAACACGAAGATTCTCGAGAATCTTCGTGTTGGCAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009098.2-131s1c1
Sequence:CCGGCTACCACAAGAAGCGAAAGTACTCGAGTACTTTCGCTTCTTGTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009098.2-275s1c1
Sequence:CCGGCTCTGAGTGTTGTACTCGCAACTCGAGTTGCGAGTACAACACTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009098.2-302s1c1
Sequence:CCGGGATCATTGATGTTGTCTACAACTCGAGTTGTAGACAACATCAATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009098
RPS8 MISSION shRNA shRNA Plasmid DNA
ribosomal protein S8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009098.2-362s1c1
Sequence:CCGGGAAGAACTGCATCGTGCTTATCTCGAGATAAGCACGATGCAGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009098.2-165s1c1
Sequence:CCGGCCCGCTGCCAACACGAAGATTCTCGAGAATCTTCGTGTTGGCAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009098.2-131s1c1
Sequence:CCGGCTACCACAAGAAGCGAAAGTACTCGAGTACTTTCGCTTCTTGTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009098.2-275s1c1
Sequence:CCGGCTCTGAGTGTTGTACTCGCAACTCGAGTTGCGAGTACAACACTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009098.2-302s1c1
Sequence:CCGGGATCATTGATGTTGTCTACAACTCGAGTTGTAGACAACATCAATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009098
RPS8 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein S8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009098.2-362s1c1
Sequence:CCGGGAAGAACTGCATCGTGCTTATCTCGAGATAAGCACGATGCAGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009098.2-165s1c1
Sequence:CCGGCCCGCTGCCAACACGAAGATTCTCGAGAATCTTCGTGTTGGCAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009098.2-131s1c1
Sequence:CCGGCTACCACAAGAAGCGAAAGTACTCGAGTACTTTCGCTTCTTGTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009098.2-275s1c1
Sequence:CCGGCTCTGAGTGTTGTACTCGCAACTCGAGTTGCGAGTACAACACTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009098.2-302s1c1
Sequence:CCGGGATCATTGATGTTGTCTACAACTCGAGTTGTAGACAACATCAATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks