EMAIL THIS PAGE TO A FRIEND

RPS9

ribosomal protein S9

Synonyms: S9
UniProtKB ID: P46781, A9C4C1, Q4QRK7, Q9BVZ0
Gene ID:
Human(6203) Summary: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S4P family of ribosomal proteins. It is located in the cytoplasm. Variable expression of this gene in colorectal cancers compared to adjacent normal tissues has been observed, although no correlation between the level of expression and the severity of the disease has been found. As is typical for genes encoding ribosomal proteins, multiple processed pseudogenes derived from this gene are dispersed through the genome. [provided by RefSeq, Jul 2008]
Mouse(76846) ribosomal protein S9
Rat(81772) ribosomal protein S9
fruit fly(39108) Ribosomal protein S9
Thale Cress(843836) 30S ribosomal protein S9
Horse(100169860) ribosomal protein S9
domestic cat(101080497) ribosomal protein S9
dog(476387) ribosomal protein S9
Zebrafish(114420) ribosomal protein S9
cow(533892) ribosomal protein S9
sheep(101102330) ribosomal protein S9
domestic guinea pig(100712808) ribosomal protein S9
naked mole-rat(101722866) ribosomal protein S9
Domestic Rabbit(100328779) ribosomal protein S9
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029767 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029767 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029767 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001013 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013 Rosetta Predictions human pricing
NM_031108 Rosetta Predictions rat pricing
NM_029767 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019645 predicted 222
2 SASI_Hs01_00019646 predicted 225
3 SASI_Hs01_00019651 predicted 422
4 SASI_Hs02_00306325 predicted 222
5 SASI_Hs02_00306326 predicted 226
6 SASI_Hs01_00019642 predicted 349
7 SASI_Hs01_00019643 predicted 350
8 SASI_Hs01_00019644 predicted 450
9 SASI_Hs01_00019647 predicted 248
10 SASI_Hs01_00019648 predicted 349
11 SASI_Hs01_00019649 predicted 264
12 SASI_Hs01_00019650 predicted 259
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031108 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264389 predicted 328
2 SASI_Rn02_00264390 predicted 323
3 SASI_Rn02_00264391 predicted 321
4 SASI_Rn02_00264392 predicted 218
5 SASI_Rn02_00264393 predicted 216
6 SASI_Rn02_00264394 predicted 514
7 SASI_Rn02_00264395 predicted 415
8 SASI_Rn02_00264396 predicted 217
9 SASI_Rn02_00264397 predicted 470
10 SASI_Rn02_00264398 predicted 517
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029767 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072255 predicted 209
2 SASI_Mm01_00072260 predicted 226
3 SASI_Mm01_00072262 predicted 214
4 SASI_Mm02_00335912 predicted 391
5 SASI_Mm02_00335913 predicted 223
6 SASI_Mm01_00072254 predicted 341
7 SASI_Mm02_00335914 predicted 429
8 SASI_Mm01_00072256 predicted 440
9 SASI_Mm01_00072257 predicted 421
10 SASI_Mm01_00072259 predicted 375
11 SASI_Mm01_00072258 predicted 381
12 SASI_Mm01_00072261 predicted 259
13 SASI_Mm01_00072263 predicted 287
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029767
VALIDATED
RPS9 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein S9
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029767.1-136s1c1
Sequence:CCGGGCTAAAGTTGATTGGAGAGTACTCGAGTACTCTCCAATCAACTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029767.1-260s1c1
Sequence:CCGGCGTCTGTTTGAAGGCAATGCTCTCGAGAGCATTGCCTTCAAACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029767.1-438s1c1
Sequence:CCGGTCATCCGCCAACGTCACATTACTCGAGTAATGTGACGTTGGCGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029767.1-127s1c1
Sequence:CCGGCGACCAGGAGCTAAAGTTGATCTCGAGATCAACTTTAGCTCCTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029767.1-349s1c1
Sequence:CCGGCCTGAAGATTGAGGATTTCTTCTCGAGAAGAAATCCTCAATCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029767.2-133s21c1
Sequence:CCGGGCTAAAGTTGATTGGAGAGTACTCGAGTACTCTCCAATCAACTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029767.2-124s21c1
Sequence:CCGGCGACCAGGAGCTAAAGTTGATCTCGAGATCAACTTTAGCTCCTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029767.2-435s21c1
Sequence:CCGGTCATCCGCCAACGTCACATTACTCGAGTAATGTGACGTTGGCGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029767.2-346s21c1
Sequence:CCGGCCTGAAGATTGAGGATTTCTTCTCGAGAAGAAATCCTCAATCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029767
VALIDATED
RPS9 MISSION shRNA shRNA Plasmid DNA
ribosomal protein S9
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029767.1-136s1c1
Sequence:CCGGGCTAAAGTTGATTGGAGAGTACTCGAGTACTCTCCAATCAACTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029767.1-260s1c1
Sequence:CCGGCGTCTGTTTGAAGGCAATGCTCTCGAGAGCATTGCCTTCAAACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029767.1-438s1c1
Sequence:CCGGTCATCCGCCAACGTCACATTACTCGAGTAATGTGACGTTGGCGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029767.1-127s1c1
Sequence:CCGGCGACCAGGAGCTAAAGTTGATCTCGAGATCAACTTTAGCTCCTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029767.1-349s1c1
Sequence:CCGGCCTGAAGATTGAGGATTTCTTCTCGAGAAGAAATCCTCAATCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029767.2-133s21c1
Sequence:CCGGGCTAAAGTTGATTGGAGAGTACTCGAGTACTCTCCAATCAACTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029767.2-124s21c1
Sequence:CCGGCGACCAGGAGCTAAAGTTGATCTCGAGATCAACTTTAGCTCCTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029767.2-435s21c1
Sequence:CCGGTCATCCGCCAACGTCACATTACTCGAGTAATGTGACGTTGGCGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029767.2-346s21c1
Sequence:CCGGCCTGAAGATTGAGGATTTCTTCTCGAGAAGAAATCCTCAATCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029767
VALIDATED
RPS9 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein S9
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029767.1-136s1c1
Sequence:CCGGGCTAAAGTTGATTGGAGAGTACTCGAGTACTCTCCAATCAACTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029767.1-260s1c1
Sequence:CCGGCGTCTGTTTGAAGGCAATGCTCTCGAGAGCATTGCCTTCAAACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029767.1-438s1c1
Sequence:CCGGTCATCCGCCAACGTCACATTACTCGAGTAATGTGACGTTGGCGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029767.1-127s1c1
Sequence:CCGGCGACCAGGAGCTAAAGTTGATCTCGAGATCAACTTTAGCTCCTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029767.1-349s1c1
Sequence:CCGGCCTGAAGATTGAGGATTTCTTCTCGAGAAGAAATCCTCAATCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029767.2-133s21c1
Sequence:CCGGGCTAAAGTTGATTGGAGAGTACTCGAGTACTCTCCAATCAACTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029767.2-124s21c1
Sequence:CCGGCGACCAGGAGCTAAAGTTGATCTCGAGATCAACTTTAGCTCCTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029767.2-435s21c1
Sequence:CCGGTCATCCGCCAACGTCACATTACTCGAGTAATGTGACGTTGGCGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029767.2-346s21c1
Sequence:CCGGCCTGAAGATTGAGGATTTCTTCTCGAGAAGAAATCCTCAATCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013
VALIDATED
RPS9 MISSION shRNA Bacterial Glycerol Stock
ribosomal protein S9
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001013.2-330s1c1
Sequence:CCGGGCCTGAAGATAGAGGATTTCTCTCGAGAGAAATCCTCTATCTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001013.2-471s1c1
Sequence:CCGGCCTTCATTGTCCGCCTGGATTCTCGAGAATCCAGGCGGACAATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001013.2-303s1c1
Sequence:CCGGGCAAGATGAAGCTGGATTACACTCGAGTGTAATCCAGCTTCATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001013.2-118s1c1
Sequence:CCGGGCTGAAGCTGATCGGCGAGTACTCGAGTACTCGCCGATCAGCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001013.3-325s21c1
Sequence:CCGGGCAAGATGAAGCTGGATTACACTCGAGTGTAATCCAGCTTCATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013.3-352s21c1
Sequence:CCGGGCCTGAAGATAGAGGATTTCTCTCGAGAGAAATCCTCTATCTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001013.3-493s21c1
Sequence:CCGGCCTTCATTGTCCGCCTGGATTCTCGAGAATCCAGGCGGACAATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_001013.3-140s21c1
Sequence:CCGGGCTGAAGCTGATCGGCGAGTACTCGAGTACTCGCCGATCAGCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013
VALIDATED
RPS9 MISSION shRNA shRNA Plasmid DNA
ribosomal protein S9
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001013.2-330s1c1
Sequence:CCGGGCCTGAAGATAGAGGATTTCTCTCGAGAGAAATCCTCTATCTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001013.2-471s1c1
Sequence:CCGGCCTTCATTGTCCGCCTGGATTCTCGAGAATCCAGGCGGACAATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001013.2-303s1c1
Sequence:CCGGGCAAGATGAAGCTGGATTACACTCGAGTGTAATCCAGCTTCATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001013.2-118s1c1
Sequence:CCGGGCTGAAGCTGATCGGCGAGTACTCGAGTACTCGCCGATCAGCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001013.3-325s21c1
Sequence:CCGGGCAAGATGAAGCTGGATTACACTCGAGTGTAATCCAGCTTCATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013.3-352s21c1
Sequence:CCGGGCCTGAAGATAGAGGATTTCTCTCGAGAGAAATCCTCTATCTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001013.3-493s21c1
Sequence:CCGGCCTTCATTGTCCGCCTGGATTCTCGAGAATCCAGGCGGACAATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_001013.3-140s21c1
Sequence:CCGGGCTGAAGCTGATCGGCGAGTACTCGAGTACTCGCCGATCAGCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013
VALIDATED
RPS9 MISSION shRNA Lentiviral Transduction Particles
ribosomal protein S9
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001013.2-330s1c1
Sequence:CCGGGCCTGAAGATAGAGGATTTCTCTCGAGAGAAATCCTCTATCTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001013.2-471s1c1
Sequence:CCGGCCTTCATTGTCCGCCTGGATTCTCGAGAATCCAGGCGGACAATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001013.2-303s1c1
Sequence:CCGGGCAAGATGAAGCTGGATTACACTCGAGTGTAATCCAGCTTCATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001013.2-118s1c1
Sequence:CCGGGCTGAAGCTGATCGGCGAGTACTCGAGTACTCGCCGATCAGCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001013.3-325s21c1
Sequence:CCGGGCAAGATGAAGCTGGATTACACTCGAGTGTAATCCAGCTTCATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013.3-352s21c1
Sequence:CCGGGCCTGAAGATAGAGGATTTCTCTCGAGAGAAATCCTCTATCTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001013.3-493s21c1
Sequence:CCGGCCTTCATTGTCCGCCTGGATTCTCGAGAATCCAGGCGGACAATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_001013.3-140s21c1
Sequence:CCGGGCTGAAGCTGATCGGCGAGTACTCGAGTACTCGCCGATCAGCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks