EMAIL THIS PAGE TO A FRIEND

RPUSD1

RNA pseudouridylate synthase domain containing 1

Synonyms: C16orf40 RLUCL
UniProtKB ID: Q9UJJ7, D3DU66
Gene ID:
Mouse(106707) RNA pseudouridylate synthase domain containing 1
Rat(287148) RNA pseudouridylate synthase domain containing 1
Zebrafish(767786) RNA pseudouridylate synthase domain containing 1
domestic cat(101087032) RNA pseudouridylate synthase domain containing 1
dog(490085) RNA pseudouridylate synthase domain containing 1
chicken(771031) RNA pseudouridylate synthase domain containing 1
cow(525521) RNA pseudouridylate synthase domain containing 1
domestic guinea pig(100718725) RNA pseudouridylate synthase domain containing 1
naked mole-rat(101708919) RNA pseudouridylate synthase domain containing 1
Gene Class: Dehydratase
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_058192 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_058192 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_058192 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028009 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028009 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028009 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU149781 MISSION® esiRNA esiRNA human RPUSD1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_058192 Rosetta Predictions human pricing
NM_001105774 Rosetta Predictions rat pricing
NM_028009 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058192 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140247 predicted 297
2 SASI_Hs01_00140248 predicted 565
3 SASI_Hs01_00140249 predicted 744
4 SASI_Hs02_00362114 predicted 1053
5 SASI_Hs01_00140250 predicted 316
6 SASI_Hs01_00140251 predicted 647
7 SASI_Hs01_00140252 predicted 290
8 SASI_Hs01_00140254 predicted 1410
9 SASI_Hs01_00140255 predicted 204
10 SASI_Hs02_00362115 predicted 740
11 SASI_Hs01_00140253 predicted 538
12 SASI_Hs01_00140256 predicted 486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105774 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212396 predicted 597
2 SASI_Rn02_00212397 predicted 1137
3 SASI_Rn02_00212398 predicted 298
4 SASI_Rn02_00212399 predicted 1469
5 SASI_Rn02_00212400 predicted 458
6 SASI_Rn02_00212401 predicted 733
7 SASI_Rn02_00212402 predicted 247
8 SASI_Rn02_00212403 predicted 1092
9 SASI_Rn02_00212404 predicted 1136
10 SASI_Rn02_00212405 predicted 692
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028009 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064104 predicted 986
2 SASI_Mm01_00064105 predicted 557
3 SASI_Mm01_00064106 predicted 441
4 SASI_Mm01_00064107 predicted 619
5 SASI_Mm01_00064108 predicted 1003
6 SASI_Mm01_00064109 predicted 597
7 SASI_Mm01_00064110 predicted 429
8 SASI_Mm01_00064111 predicted 262
9 SASI_Mm01_00064112 predicted 659
10 SASI_Mm01_00064113 predicted 715
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_058192
VALIDATED
RPUSD1 MISSION shRNA Bacterial Glycerol Stock
RNA pseudouridylate synthase domain containing 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058192.2-211s21c1
Sequence:CCGGGACGTTCGCATTGACAGCAAGCTCGAGCTTGCTGTCAATGCGAACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058192.2-1409s21c1
Sequence:CCGGTACGGACTCAAGGTCACCTCACTCGAGTGAGGTGACCTTGAGTCCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058192.2-575s21c1
Sequence:CCGGATCTCGTGGTTCTGGAACACGCTCGAGCGTGTTCCAGAACCACGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058192.2-452s21c1
Sequence:CCGGACATCCAGGAGAGCCGGGTAACTCGAGTTACCCGGCTCTCCTGGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_058192.2-469s1c1
Sequence:CCGGGTAACCATCAGCCATGCCATTCTCGAGAATGGCATGGCTGATGGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058192.2-539s1c1
Sequence:CCGGCGCAGGGTTGTGAGAACCCAACTCGAGTTGGGTTCTCACAACCCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058192.2-604s1c1
Sequence:CCGGGCAGGCGATCCTGTCTCCAAACTCGAGTTTGGAGACAGGATCGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_058192.2-180s1c1
Sequence:CCGGCCGCGACTTCCTGGTGGTCAACTCGAGTTGACCACCAGGAAGTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_058192.2-747s1c1
Sequence:CCGGCAGAATGATGCTGCACGCTTTCTCGAGAAAGCGTGCAGCATCATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_058192
VALIDATED
RPUSD1 MISSION shRNA shRNA Plasmid DNA
RNA pseudouridylate synthase domain containing 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058192.2-211s21c1
Sequence:CCGGGACGTTCGCATTGACAGCAAGCTCGAGCTTGCTGTCAATGCGAACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058192.2-1409s21c1
Sequence:CCGGTACGGACTCAAGGTCACCTCACTCGAGTGAGGTGACCTTGAGTCCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058192.2-575s21c1
Sequence:CCGGATCTCGTGGTTCTGGAACACGCTCGAGCGTGTTCCAGAACCACGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058192.2-452s21c1
Sequence:CCGGACATCCAGGAGAGCCGGGTAACTCGAGTTACCCGGCTCTCCTGGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_058192.2-469s1c1
Sequence:CCGGGTAACCATCAGCCATGCCATTCTCGAGAATGGCATGGCTGATGGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058192.2-539s1c1
Sequence:CCGGCGCAGGGTTGTGAGAACCCAACTCGAGTTGGGTTCTCACAACCCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058192.2-604s1c1
Sequence:CCGGGCAGGCGATCCTGTCTCCAAACTCGAGTTTGGAGACAGGATCGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_058192.2-180s1c1
Sequence:CCGGCCGCGACTTCCTGGTGGTCAACTCGAGTTGACCACCAGGAAGTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_058192.2-747s1c1
Sequence:CCGGCAGAATGATGCTGCACGCTTTCTCGAGAAAGCGTGCAGCATCATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_058192
VALIDATED
RPUSD1 MISSION shRNA Lentiviral Transduction Particles
RNA pseudouridylate synthase domain containing 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058192.2-211s21c1
Sequence:CCGGGACGTTCGCATTGACAGCAAGCTCGAGCTTGCTGTCAATGCGAACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058192.2-1409s21c1
Sequence:CCGGTACGGACTCAAGGTCACCTCACTCGAGTGAGGTGACCTTGAGTCCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058192.2-575s21c1
Sequence:CCGGATCTCGTGGTTCTGGAACACGCTCGAGCGTGTTCCAGAACCACGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058192.2-452s21c1
Sequence:CCGGACATCCAGGAGAGCCGGGTAACTCGAGTTACCCGGCTCTCCTGGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_058192.2-469s1c1
Sequence:CCGGGTAACCATCAGCCATGCCATTCTCGAGAATGGCATGGCTGATGGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058192.2-539s1c1
Sequence:CCGGCGCAGGGTTGTGAGAACCCAACTCGAGTTGGGTTCTCACAACCCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058192.2-604s1c1
Sequence:CCGGGCAGGCGATCCTGTCTCCAAACTCGAGTTTGGAGACAGGATCGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_058192.2-180s1c1
Sequence:CCGGCCGCGACTTCCTGGTGGTCAACTCGAGTTGACCACCAGGAAGTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_058192.2-747s1c1
Sequence:CCGGCAGAATGATGCTGCACGCTTTCTCGAGAAAGCGTGCAGCATCATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028009
VALIDATED
RPUSD1 MISSION shRNA Bacterial Glycerol Stock
RNA pseudouridylate synthase domain containing 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000328120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028009.3-348s21c1
Sequence:CCGGGCTGCGGGCAGTGCTTATAAACTCGAGTTTATAAGCACTGCCCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028009.3-552s21c1
Sequence:CCGGGTCCTGGAACACGGCCTATATCTCGAGATATAGGCCGTGTTCCAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028009.3-728s21c1
Sequence:CCGGGCACGCCTTCTACCTACGCATCTCGAGATGCGTAGGTAGAAGGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028009.3-438s21c1
Sequence:CCGGGTGACGATCAACTATGCCATTCTCGAGAATGGCATAGTTGATCGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028009.1-439s1c1
Sequence:CCGGGTGACGATCAACTATGCCATTCTCGAGAATGGCATAGTTGATCGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028009.1-729s1c1
Sequence:CCGGGCACGCCTTCTACCTACGCATCTCGAGATGCGTAGGTAGAAGGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028009.1-585s1c1
Sequence:CCGGTGTGTCCAAAGTGCTGCTAAACTCGAGTTTAGCAGCACTTTGGACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120057    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028009.1-1510s1c1
Sequence:CCGGCTTCTGTTCTATGGGCTCCTACTCGAGTAGGAGCCCATAGAACAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028009.1-993s1c1
Sequence:CCGGGCTATCAGAGTGGACACTAGACTCGAGTCTAGTGTCCACTCTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028009
VALIDATED
RPUSD1 MISSION shRNA shRNA Plasmid DNA
RNA pseudouridylate synthase domain containing 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000328120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028009.3-348s21c1
Sequence:CCGGGCTGCGGGCAGTGCTTATAAACTCGAGTTTATAAGCACTGCCCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028009.3-552s21c1
Sequence:CCGGGTCCTGGAACACGGCCTATATCTCGAGATATAGGCCGTGTTCCAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028009.3-728s21c1
Sequence:CCGGGCACGCCTTCTACCTACGCATCTCGAGATGCGTAGGTAGAAGGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028009.3-438s21c1
Sequence:CCGGGTGACGATCAACTATGCCATTCTCGAGAATGGCATAGTTGATCGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028009.1-439s1c1
Sequence:CCGGGTGACGATCAACTATGCCATTCTCGAGAATGGCATAGTTGATCGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028009.1-729s1c1
Sequence:CCGGGCACGCCTTCTACCTACGCATCTCGAGATGCGTAGGTAGAAGGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028009.1-585s1c1
Sequence:CCGGTGTGTCCAAAGTGCTGCTAAACTCGAGTTTAGCAGCACTTTGGACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120057    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028009.1-1510s1c1
Sequence:CCGGCTTCTGTTCTATGGGCTCCTACTCGAGTAGGAGCCCATAGAACAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028009.1-993s1c1
Sequence:CCGGGCTATCAGAGTGGACACTAGACTCGAGTCTAGTGTCCACTCTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028009
VALIDATED
RPUSD1 MISSION shRNA Lentiviral Transduction Particles
RNA pseudouridylate synthase domain containing 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000328120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028009.3-348s21c1
Sequence:CCGGGCTGCGGGCAGTGCTTATAAACTCGAGTTTATAAGCACTGCCCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028009.3-552s21c1
Sequence:CCGGGTCCTGGAACACGGCCTATATCTCGAGATATAGGCCGTGTTCCAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028009.3-728s21c1
Sequence:CCGGGCACGCCTTCTACCTACGCATCTCGAGATGCGTAGGTAGAAGGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028009.3-438s21c1
Sequence:CCGGGTGACGATCAACTATGCCATTCTCGAGAATGGCATAGTTGATCGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028009.1-439s1c1
Sequence:CCGGGTGACGATCAACTATGCCATTCTCGAGAATGGCATAGTTGATCGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028009.1-729s1c1
Sequence:CCGGGCACGCCTTCTACCTACGCATCTCGAGATGCGTAGGTAGAAGGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028009.1-585s1c1
Sequence:CCGGTGTGTCCAAAGTGCTGCTAAACTCGAGTTTAGCAGCACTTTGGACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120057    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028009.1-1510s1c1
Sequence:CCGGCTTCTGTTCTATGGGCTCCTACTCGAGTAGGAGCCCATAGAACAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028009.1-993s1c1
Sequence:CCGGGCTATCAGAGTGGACACTAGACTCGAGTCTAGTGTCCACTCTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks