EMAIL THIS PAGE TO A FRIEND

RQCD1

RCD1 required for cell differentiation1 homolog (S. pombe)

Synonyms: CNOT9 CT129 RCD-1 RCD1
UniProtKB ID: Q92600, B2RPI0, Q96IX4
Gene ID:
Human(9125) Summary: This gene encodes a member of the highly conserved RCD1 protein family. The encoded protein is a transcriptional cofactor and a core protein of the CCR4-NOT complex. It may be involved in signal transduction as well as retinoic acid-regulated cell differentiation and development. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Oct 2012]
Mouse(58184) rcd1 (required for cell differentiation) homolog 1 (S. pombe)
Rat(301513) Rcd1 required for cell differentiation1 homolog (S. pombe)
Zebrafish(406632) RCD1 required for cell differentiation1 homolog (S. pombe)
domestic cat(101090202) RCD1 required for cell differentiation1 homolog (S. pombe)
chicken(424215) RCD1 required for cell differentiation1 homolog (S. pombe)
dog(610449) RCD1 required for cell differentiation1 homolog (S. pombe)
cow(536537) RCD1 required for cell differentiation1 homolog (S. pombe)
sheep(101111075) RCD1 required for cell differentiation1 homolog (S. pombe)
domestic guinea pig(100714731) RCD1 required for cell differentiation1 homolog (S. pombe)
naked mole-rat(101704652) RCD1 required for cell differentiation1 homolog (S. pombe)
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021383 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021383 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021383 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005444 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005444 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005444 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005444 Rosetta Predictions human pricing
NM_001009357 Rosetta Predictions rat pricing
NM_021383 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005444 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208294 predicted 567
2 SASI_Hs01_00208295 predicted 251
3 SASI_Hs01_00208297 predicted 513
4 SASI_Hs01_00208298 predicted 616
5 SASI_Hs01_00208299 predicted 319
6 SASI_Hs01_00208300 predicted 667
7 SASI_Hs01_00208301 predicted 493
8 SASI_Hs01_00208302 predicted 619
9 SASI_Hs02_00339603 predicted 472
10 SASI_Hs02_00339604 predicted 599
11 SASI_Hs01_00208293 predicted 486
12 SASI_Hs01_00208296 predicted 646
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009357 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062986 predicted 917
2 SASI_Rn01_00062987 predicted 1003
3 SASI_Rn02_00199518 predicted 890
4 SASI_Rn01_00062989 predicted 591
5 SASI_Rn01_00062990 predicted 868
6 SASI_Rn02_00199519 predicted 469
7 SASI_Rn01_00062991 predicted 668
8 SASI_Rn01_00062992 predicted 1352
9 SASI_Rn01_00062993 predicted 1188
10 SASI_Rn01_00062994 predicted 480
11 SASI_Rn01_00062988 predicted 593
12 SASI_Rn01_00062995 predicted 1328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021383 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080129 predicted 465
2 SASI_Mm01_00080130 predicted 378
3 SASI_Mm01_00080131 predicted 662
4 SASI_Mm01_00080132 predicted 474
5 SASI_Mm01_00080133 predicted 417
6 SASI_Mm01_00080134 predicted 320
7 SASI_Mm02_00325975 predicted 918
8 SASI_Mm01_00080136 predicted 414
9 SASI_Mm01_00080137 predicted 390
10 SASI_Mm01_00080138 predicted 781
11 SASI_Mm01_00080135 predicted 972
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021383
VALIDATED
RQCD1 MISSION shRNA Bacterial Glycerol Stock
RCD1 required for cell differentiation1 homolog (S. pombe)
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021383.5-547s21c1
Sequence:CCGGTGGCATTCATTTGGTACTATTCTCGAGAATAGTACCAAATGAATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217211    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021383.4-769s1c1
Sequence:CCGGCATACTCCAGAAGATCCTCTTCTCGAGAAGAGGATCTTCTGGAGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021383.4-842s1c1
Sequence:CCGGGTTGCCATGATCTTGGGTAAACTCGAGTTTACCCAAGATCATGGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320060    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021383.4-1661s21c1
Sequence:CCGGGCACTGTTTACAAGTCTGTTACTCGAGTAACAGACTTGTAAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021383.4-733s21c1
Sequence:CCGGGTCTGGAAGTGAACTCTCTAACTCGAGTTAGAGAGTTCACTTCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021383.4-277s21c1
Sequence:CCGGGAAGATCTATCAGTGGATCAACTCGAGTTGATCCACTGATAGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021383.5-954s21c1
Sequence:CCGGTGACACTGGTTTAGCTTATATCTCGAGATATAAGCTAAACCAGTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021383.3-896s1c1
Sequence:CCGGGTCTGGAAGTGAACTCTCTAACTCGAGTTAGAGAGTTCACTTCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181700    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021383.3-2953s1c1
Sequence:CCGGGCTGAGCTGAAGTCTTTCATTCTCGAGAATGAAAGACTTCAGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178419    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021383.3-1824s1c1
Sequence:CCGGGCACTGTTTACAAGTCTGTTACTCGAGTAACAGACTTGTAAACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021383.3-440s1c1
Sequence:CCGGGAAGATCTATCAGTGGATCAACTCGAGTTGATCCACTGATAGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021383.3-1212s1c1
Sequence:CCGGCAACTGGTGAAGAACCTGCAACTCGAGTTGCAGGTTCTTCACCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200061    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021383.3-2593s1c1
Sequence:CCGGCCCGTGTCTCATACACTTGAACTCGAGTTCAAGTGTATGAGACACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021383.3-540s1c1
Sequence:CCGGCCCATGCTATGGCATTCATTTCTCGAGAAATGAATGCCATAGCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021383
VALIDATED
RQCD1 MISSION shRNA shRNA Plasmid DNA
RCD1 required for cell differentiation1 homolog (S. pombe)
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021383.5-547s21c1
Sequence:CCGGTGGCATTCATTTGGTACTATTCTCGAGAATAGTACCAAATGAATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217211    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021383.4-769s1c1
Sequence:CCGGCATACTCCAGAAGATCCTCTTCTCGAGAAGAGGATCTTCTGGAGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021383.4-842s1c1
Sequence:CCGGGTTGCCATGATCTTGGGTAAACTCGAGTTTACCCAAGATCATGGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320060    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021383.4-1661s21c1
Sequence:CCGGGCACTGTTTACAAGTCTGTTACTCGAGTAACAGACTTGTAAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021383.4-733s21c1
Sequence:CCGGGTCTGGAAGTGAACTCTCTAACTCGAGTTAGAGAGTTCACTTCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021383.4-277s21c1
Sequence:CCGGGAAGATCTATCAGTGGATCAACTCGAGTTGATCCACTGATAGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021383.5-954s21c1
Sequence:CCGGTGACACTGGTTTAGCTTATATCTCGAGATATAAGCTAAACCAGTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021383.3-896s1c1
Sequence:CCGGGTCTGGAAGTGAACTCTCTAACTCGAGTTAGAGAGTTCACTTCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181700    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021383.3-2953s1c1
Sequence:CCGGGCTGAGCTGAAGTCTTTCATTCTCGAGAATGAAAGACTTCAGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178419    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021383.3-1824s1c1
Sequence:CCGGGCACTGTTTACAAGTCTGTTACTCGAGTAACAGACTTGTAAACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021383.3-440s1c1
Sequence:CCGGGAAGATCTATCAGTGGATCAACTCGAGTTGATCCACTGATAGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021383.3-1212s1c1
Sequence:CCGGCAACTGGTGAAGAACCTGCAACTCGAGTTGCAGGTTCTTCACCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200061    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021383.3-2593s1c1
Sequence:CCGGCCCGTGTCTCATACACTTGAACTCGAGTTCAAGTGTATGAGACACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021383.3-540s1c1
Sequence:CCGGCCCATGCTATGGCATTCATTTCTCGAGAAATGAATGCCATAGCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021383
VALIDATED
RQCD1 MISSION shRNA Lentiviral Transduction Particles
RCD1 required for cell differentiation1 homolog (S. pombe)
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021383.5-547s21c1
Sequence:CCGGTGGCATTCATTTGGTACTATTCTCGAGAATAGTACCAAATGAATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217211    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021383.4-769s1c1
Sequence:CCGGCATACTCCAGAAGATCCTCTTCTCGAGAAGAGGATCTTCTGGAGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021383.4-842s1c1
Sequence:CCGGGTTGCCATGATCTTGGGTAAACTCGAGTTTACCCAAGATCATGGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320060    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021383.4-1661s21c1
Sequence:CCGGGCACTGTTTACAAGTCTGTTACTCGAGTAACAGACTTGTAAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021383.4-733s21c1
Sequence:CCGGGTCTGGAAGTGAACTCTCTAACTCGAGTTAGAGAGTTCACTTCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021383.4-277s21c1
Sequence:CCGGGAAGATCTATCAGTGGATCAACTCGAGTTGATCCACTGATAGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021383.5-954s21c1
Sequence:CCGGTGACACTGGTTTAGCTTATATCTCGAGATATAAGCTAAACCAGTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021383.3-896s1c1
Sequence:CCGGGTCTGGAAGTGAACTCTCTAACTCGAGTTAGAGAGTTCACTTCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181700    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021383.3-2953s1c1
Sequence:CCGGGCTGAGCTGAAGTCTTTCATTCTCGAGAATGAAAGACTTCAGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178419    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021383.3-1824s1c1
Sequence:CCGGGCACTGTTTACAAGTCTGTTACTCGAGTAACAGACTTGTAAACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021383.3-440s1c1
Sequence:CCGGGAAGATCTATCAGTGGATCAACTCGAGTTGATCCACTGATAGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021383.3-1212s1c1
Sequence:CCGGCAACTGGTGAAGAACCTGCAACTCGAGTTGCAGGTTCTTCACCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200061    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021383.3-2593s1c1
Sequence:CCGGCCCGTGTCTCATACACTTGAACTCGAGTTCAAGTGTATGAGACACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021383.3-540s1c1
Sequence:CCGGCCCATGCTATGGCATTCATTTCTCGAGAAATGAATGCCATAGCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005444
VALIDATED
RQCD1 MISSION shRNA Bacterial Glycerol Stock
RCD1 required for cell differentiation1 homolog (S. pombe)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005444.1-255s21c1
Sequence:CCGGCCAGTCTAACAGAGTTTGCAACTCGAGTTGCAAACTCTGTTAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005444.1-556s21c1
Sequence:CCGGCTCCAGAAGATCTTGTTAGATCTCGAGATCTAACAAGATCTTCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005444.1-690s21c1
Sequence:CCGGGCATGTAGTGAGATGTTACCTCTCGAGAGGTAACATCTCACTACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005444.1-121s21c1
Sequence:CCGGGAGCTAAGTAAGAAGCGAGAACTCGAGTTCTCGCTTCTTACTTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005444.1-121s1c1
Sequence:CCGGGAGCTAAGTAAGAAGCGAGAACTCGAGTTCTCGCTTCTTACTTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005444.1-255s1c1
Sequence:CCGGCCAGTCTAACAGAGTTTGCAACTCGAGTTGCAAACTCTGTTAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005444.1-690s1c1
Sequence:CCGGGCATGTAGTGAGATGTTACCTCTCGAGAGGTAACATCTCACTACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005444.1-556s1c1
Sequence:CCGGCTCCAGAAGATCTTGTTAGATCTCGAGATCTAACAAGATCTTCTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005444.1-687s1c1
Sequence:CCGGGAAGCATGTAGTGAGATGTTACTCGAGTAACATCTCACTACATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005444
VALIDATED
RQCD1 MISSION shRNA shRNA Plasmid DNA
RCD1 required for cell differentiation1 homolog (S. pombe)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005444.1-255s21c1
Sequence:CCGGCCAGTCTAACAGAGTTTGCAACTCGAGTTGCAAACTCTGTTAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005444.1-556s21c1
Sequence:CCGGCTCCAGAAGATCTTGTTAGATCTCGAGATCTAACAAGATCTTCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005444.1-690s21c1
Sequence:CCGGGCATGTAGTGAGATGTTACCTCTCGAGAGGTAACATCTCACTACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005444.1-121s21c1
Sequence:CCGGGAGCTAAGTAAGAAGCGAGAACTCGAGTTCTCGCTTCTTACTTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005444.1-121s1c1
Sequence:CCGGGAGCTAAGTAAGAAGCGAGAACTCGAGTTCTCGCTTCTTACTTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005444.1-255s1c1
Sequence:CCGGCCAGTCTAACAGAGTTTGCAACTCGAGTTGCAAACTCTGTTAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005444.1-690s1c1
Sequence:CCGGGCATGTAGTGAGATGTTACCTCTCGAGAGGTAACATCTCACTACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005444.1-556s1c1
Sequence:CCGGCTCCAGAAGATCTTGTTAGATCTCGAGATCTAACAAGATCTTCTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005444.1-687s1c1
Sequence:CCGGGAAGCATGTAGTGAGATGTTACTCGAGTAACATCTCACTACATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005444
VALIDATED
RQCD1 MISSION shRNA Lentiviral Transduction Particles
RCD1 required for cell differentiation1 homolog (S. pombe)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005444.1-255s21c1
Sequence:CCGGCCAGTCTAACAGAGTTTGCAACTCGAGTTGCAAACTCTGTTAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005444.1-556s21c1
Sequence:CCGGCTCCAGAAGATCTTGTTAGATCTCGAGATCTAACAAGATCTTCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005444.1-690s21c1
Sequence:CCGGGCATGTAGTGAGATGTTACCTCTCGAGAGGTAACATCTCACTACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005444.1-121s21c1
Sequence:CCGGGAGCTAAGTAAGAAGCGAGAACTCGAGTTCTCGCTTCTTACTTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005444.1-121s1c1
Sequence:CCGGGAGCTAAGTAAGAAGCGAGAACTCGAGTTCTCGCTTCTTACTTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005444.1-255s1c1
Sequence:CCGGCCAGTCTAACAGAGTTTGCAACTCGAGTTGCAAACTCTGTTAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005444.1-690s1c1
Sequence:CCGGGCATGTAGTGAGATGTTACCTCTCGAGAGGTAACATCTCACTACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005444.1-556s1c1
Sequence:CCGGCTCCAGAAGATCTTGTTAGATCTCGAGATCTAACAAGATCTTCTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005444.1-687s1c1
Sequence:CCGGGAAGCATGTAGTGAGATGTTACTCGAGTAACATCTCACTACATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks