EMAIL THIS PAGE TO A FRIEND

RRP8

ribosomal RNA processing 8, methyltransferase, homolog (yeast)

Synonyms: KIAA0409
UniProtKB ID: O43159, Q7KZ78, Q9BVM6
Gene ID:
Mouse(101867) ribosomal RNA processing 8, methyltransferase, homolog (yeast)
Rat(308911) ribosomal RNA processing 8, methyltransferase, homolog (yeast)
chicken(425225) ribosomal RNA processing 8, methyltransferase, homolog (yeast)
domestic cat(101092542) ribosomal RNA processing 8, methyltransferase, homolog (yeast)
dog(476835) ribosomal RNA processing 8, methyltransferase, homolog (yeast)
cow(540208) ribosomal RNA processing 8, methyltransferase, homolog (yeast)
sheep(101117103) ribosomal RNA processing 8, methyltransferase, homolog (yeast)
domestic guinea pig(101788966) ribosomal RNA processing 8, methyltransferase, homolog (yeast)
naked mole-rat(101706824) ribosomal RNA processing 8, methyltransferase, homolog (yeast)
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025897 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025897 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025897 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015324 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015324 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015324 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU010111 MISSION® esiRNA esiRNA targeting human KIAA0409 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015324 Rosetta Predictions human pricing
NM_001008346 Rosetta Predictions rat pricing
NM_025897 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015324 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089801 predicted 1302
2 SASI_Hs01_00089802 predicted 819
3 SASI_Hs01_00089803 predicted 307
4 SASI_Hs01_00089804 predicted 1069
5 SASI_Hs01_00089805 predicted 611
6 SASI_Hs02_00347603 predicted 1343
7 SASI_Hs01_00089806 predicted 1188
8 SASI_Hs01_00089807 predicted 838
9 SASI_Hs01_00089808 predicted 656
10 SASI_Hs01_00089809 predicted 1233
11 SASI_Hs01_00089800 predicted 1300
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008346 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120975 predicted 1437
2 SASI_Rn01_00120976 predicted 459
3 SASI_Rn01_00120977 predicted 537
4 SASI_Rn01_00120978 predicted 516
5 SASI_Rn01_00120979 predicted 1391
6 SASI_Rn01_00120980 predicted 652
7 SASI_Rn01_00120981 predicted 1000
8 SASI_Rn01_00120982 predicted 502
9 SASI_Rn01_00120983 predicted 887
10 SASI_Rn01_00120984 predicted 506
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025897 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182961 predicted 224
2 SASI_Mm01_00182962 predicted 1529
3 SASI_Mm01_00182963 predicted 787
4 SASI_Mm01_00182964 predicted 850
5 SASI_Mm01_00182965 predicted 621
6 SASI_Mm01_00182966 predicted 549
7 SASI_Mm01_00182967 predicted 1323
8 SASI_Mm01_00182968 predicted 1207
9 SASI_Mm01_00182969 predicted 774
10 SASI_Mm01_00182970 predicted 563
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025897
VALIDATED
RRP8 MISSION shRNA Bacterial Glycerol Stock
ribosomal RNA processing 8, methyltransferase, homolog (yeast)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025897.1-852s21c1
Sequence:CCGGGCCCGATTTCGCTACCTTAATCTCGAGATTAAGGTAGCGAAATCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278772    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025897.1-1610s21c1
Sequence:CCGGCCAGCTCAGCTCTACTCTAATCTCGAGATTAGAGTAGAGCTGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025897.1-1337s21c1
Sequence:CCGGCGGCTTTAAGATTATCTACAACTCGAGTTGTAGATAATCTTAAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025897.1-1195s21c1
Sequence:CCGGGCCTTTCACTGATGGGAACTACTCGAGTAGTTCCCATCAGTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025897.1-620s21c1
Sequence:CCGGCCCTGAGTCTATGTCACCTAACTCGAGTTAGGTGACATAGACTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025897.1-620s1c1
Sequence:CCGGCCCTGAGTCTATGTCACCTAACTCGAGTTAGGTGACATAGACTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025897.1-780s1c1
Sequence:CCGGGTCCCAAAGTCAGATAGTCAACTCGAGTTGACTATCTGACTTTGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025897.1-1195s1c1
Sequence:CCGGGCCTTTCACTGATGGGAACTACTCGAGTAGTTCCCATCAGTGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025897.1-1337s1c1
Sequence:CCGGCGGCTTTAAGATTATCTACAACTCGAGTTGTAGATAATCTTAAAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025897
VALIDATED
RRP8 MISSION shRNA shRNA Plasmid DNA
ribosomal RNA processing 8, methyltransferase, homolog (yeast)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025897.1-852s21c1
Sequence:CCGGGCCCGATTTCGCTACCTTAATCTCGAGATTAAGGTAGCGAAATCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278772    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025897.1-1610s21c1
Sequence:CCGGCCAGCTCAGCTCTACTCTAATCTCGAGATTAGAGTAGAGCTGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025897.1-1337s21c1
Sequence:CCGGCGGCTTTAAGATTATCTACAACTCGAGTTGTAGATAATCTTAAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025897.1-1195s21c1
Sequence:CCGGGCCTTTCACTGATGGGAACTACTCGAGTAGTTCCCATCAGTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025897.1-620s21c1
Sequence:CCGGCCCTGAGTCTATGTCACCTAACTCGAGTTAGGTGACATAGACTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025897.1-620s1c1
Sequence:CCGGCCCTGAGTCTATGTCACCTAACTCGAGTTAGGTGACATAGACTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025897.1-780s1c1
Sequence:CCGGGTCCCAAAGTCAGATAGTCAACTCGAGTTGACTATCTGACTTTGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025897.1-1195s1c1
Sequence:CCGGGCCTTTCACTGATGGGAACTACTCGAGTAGTTCCCATCAGTGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025897.1-1337s1c1
Sequence:CCGGCGGCTTTAAGATTATCTACAACTCGAGTTGTAGATAATCTTAAAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025897
VALIDATED
RRP8 MISSION shRNA Lentiviral Transduction Particles
ribosomal RNA processing 8, methyltransferase, homolog (yeast)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025897.1-852s21c1
Sequence:CCGGGCCCGATTTCGCTACCTTAATCTCGAGATTAAGGTAGCGAAATCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278772    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025897.1-1610s21c1
Sequence:CCGGCCAGCTCAGCTCTACTCTAATCTCGAGATTAGAGTAGAGCTGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025897.1-1337s21c1
Sequence:CCGGCGGCTTTAAGATTATCTACAACTCGAGTTGTAGATAATCTTAAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025897.1-1195s21c1
Sequence:CCGGGCCTTTCACTGATGGGAACTACTCGAGTAGTTCCCATCAGTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025897.1-620s21c1
Sequence:CCGGCCCTGAGTCTATGTCACCTAACTCGAGTTAGGTGACATAGACTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025897.1-620s1c1
Sequence:CCGGCCCTGAGTCTATGTCACCTAACTCGAGTTAGGTGACATAGACTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025897.1-780s1c1
Sequence:CCGGGTCCCAAAGTCAGATAGTCAACTCGAGTTGACTATCTGACTTTGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025897.1-1195s1c1
Sequence:CCGGGCCTTTCACTGATGGGAACTACTCGAGTAGTTCCCATCAGTGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025897.1-1337s1c1
Sequence:CCGGCGGCTTTAAGATTATCTACAACTCGAGTTGTAGATAATCTTAAAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015324
RRP8 MISSION shRNA Bacterial Glycerol Stock
ribosomal RNA processing 8, methyltransferase, homolog (yeast)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015324.2-1333s1c1
Sequence:CCGGCCTGACCAACAGCCATTTCTTCTCGAGAAGAAATGGCTGTTGGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015324.2-1300s1c1
Sequence:CCGGGACCAAGCTAGGCTTCAAGATCTCGAGATCTTGAAGCCTAGCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015324.2-404s1c1
Sequence:CCGGGAAGTAGAAAGGAAGAAGAAACTCGAGTTTCTTCTTCCTTTCTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015324.2-1339s1c1
Sequence:CCGGCAACAGCCATTTCTTCTTGTTCTCGAGAACAAGAAGAAATGGCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015324.2-570s1c1
Sequence:CCGGCAAATGATCCACCAAAGCAAACTCGAGTTTGCTTTGGTGGATCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015324
RRP8 MISSION shRNA shRNA Plasmid DNA
ribosomal RNA processing 8, methyltransferase, homolog (yeast)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015324.2-1333s1c1
Sequence:CCGGCCTGACCAACAGCCATTTCTTCTCGAGAAGAAATGGCTGTTGGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015324.2-1300s1c1
Sequence:CCGGGACCAAGCTAGGCTTCAAGATCTCGAGATCTTGAAGCCTAGCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015324.2-404s1c1
Sequence:CCGGGAAGTAGAAAGGAAGAAGAAACTCGAGTTTCTTCTTCCTTTCTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015324.2-1339s1c1
Sequence:CCGGCAACAGCCATTTCTTCTTGTTCTCGAGAACAAGAAGAAATGGCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015324.2-570s1c1
Sequence:CCGGCAAATGATCCACCAAAGCAAACTCGAGTTTGCTTTGGTGGATCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015324
RRP8 MISSION shRNA Lentiviral Transduction Particles
ribosomal RNA processing 8, methyltransferase, homolog (yeast)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015324.2-1333s1c1
Sequence:CCGGCCTGACCAACAGCCATTTCTTCTCGAGAAGAAATGGCTGTTGGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015324.2-1300s1c1
Sequence:CCGGGACCAAGCTAGGCTTCAAGATCTCGAGATCTTGAAGCCTAGCTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015324.2-404s1c1
Sequence:CCGGGAAGTAGAAAGGAAGAAGAAACTCGAGTTTCTTCTTCCTTTCTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015324.2-1339s1c1
Sequence:CCGGCAACAGCCATTTCTTCTTGTTCTCGAGAACAAGAAGAAATGGCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015324.2-570s1c1
Sequence:CCGGCAAATGATCCACCAAAGCAAACTCGAGTTTGCTTTGGTGGATCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks