EMAIL THIS PAGE TO A FRIEND

RSAD1

radical S-adenosyl methionine domain containing 1

UniProtKB ID: Q9HA92, Q53HV8, Q86VC4, Q9BRY7, Q9NUS7
Gene ID:
Mouse(237926) radical S-adenosyl methionine domain containing 1
Rat(688146) radical S-adenosyl methionine domain containing 1
Zebrafish(565897) radical S-adenosyl methionine domain containing 1
dog(609330) radical S-adenosyl methionine domain containing 1
domestic cat(101090405) radical S-adenosyl methionine domain containing 1
Horse(100069955) radical S-adenosyl methionine domain containing 1
domestic guinea pig(100731645) radical S-adenosyl methionine domain containing 1
naked mole-rat(101706556) radical S-adenosyl methionine domain containing 1
cow(615755) radical S-adenosyl methionine domain containing 1
sheep(101105341) radical S-adenosyl methionine domain containing 1
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018346 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018346 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018346 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001013381 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013381 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013381 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018346 Rosetta Predictions human pricing
XM_001081294 Rosetta Predictions rat pricing
NM_001013381 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018346 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244384 predicted 1535
2 SASI_Hs01_00244385 predicted 1736
3 SASI_Hs02_00351796 predicted 1680
4 SASI_Hs02_00351797 predicted 1538
5 SASI_Hs02_00351798 predicted 1545
6 SASI_Hs01_00244386 predicted 902
7 SASI_Hs01_00244387 predicted 612
8 SASI_Hs01_00244388 predicted 921
9 SASI_Hs01_00244389 predicted 1681
10 SASI_Hs01_00244390 predicted 270
11 SASI_Hs01_00244391 predicted 1406
12 SASI_Hs01_00244392 predicted 1721
13 SASI_Hs01_00244393 predicted 1453
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081294 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00371358 predicted 296
2 SASI_Rn02_00371359 predicted 914
3 SASI_Rn02_00371360 predicted 521
4 SASI_Rn02_00371361 predicted 865
5 SASI_Rn02_00371362 predicted 1181
6 SASI_Rn02_00371363 predicted 825
7 SASI_Rn02_00371364 predicted 939
8 SASI_Rn02_00371365 predicted 893
9 SASI_Rn02_00371366 predicted 927
10 SASI_Rn02_00371367 predicted 732
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013381 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051917 predicted 1758
2 SASI_Mm01_00051918 predicted 1447
3 SASI_Mm01_00051919 predicted 528
4 SASI_Mm01_00051920 predicted 898
5 SASI_Mm01_00051921 predicted 1716
6 SASI_Mm01_00051922 predicted 891
7 SASI_Mm01_00051923 predicted 463
8 SASI_Mm01_00051924 predicted 1822
9 SASI_Mm01_00051925 predicted 1775
10 SASI_Mm01_00051926 predicted 1074
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018346
VALIDATED
RSAD1 MISSION shRNA Bacterial Glycerol Stock
radical S-adenosyl methionine domain containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_018346.1-221s21c1
Sequence:CCGGCTGCAACTTCAACAAGTACATCTCGAGATGTACTTGTTGAAGTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303395    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_018346.1-1805s21c1
Sequence:CCGGAGCAGGAAGGGATCTACTATACTCGAGTATAGTAGATCCCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_018346.1-626s21c1
Sequence:CCGGGCGCGTGTCTGTAGACTTGATCTCGAGATCAAGTCTACAGACACGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_018346.1-905s21c1
Sequence:CCGGCAGTACCCACAATTGGACTTACTCGAGTAAGTCCAATTGTGGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_018346.1-502s21c1
Sequence:CCGGGGGTTAACAGGTTGTCTATAGCTCGAGCTATAGACAACCTGTTAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_018346.1-221s1c1
Sequence:CCGGCTGCAACTTCAACAAGTACATCTCGAGATGTACTTGTTGAAGTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018346.1-179s1c1
Sequence:CCGGGCTTTACGTACACTGGCCTTACTCGAGTAAGGCCAGTGTACGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_018346.1-905s1c1
Sequence:CCGGCAGTACCCACAATTGGACTTACTCGAGTAAGTCCAATTGTGGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018346.1-626s1c1
Sequence:CCGGGCGCGTGTCTGTAGACTTGATCTCGAGATCAAGTCTACAGACACGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018346.1-863s1c1
Sequence:CCGGCCACCAGTATGAGGTCTCCAACTCGAGTTGGAGACCTCATACTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018346
VALIDATED
RSAD1 MISSION shRNA shRNA Plasmid DNA
radical S-adenosyl methionine domain containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_018346.1-221s21c1
Sequence:CCGGCTGCAACTTCAACAAGTACATCTCGAGATGTACTTGTTGAAGTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303395    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_018346.1-1805s21c1
Sequence:CCGGAGCAGGAAGGGATCTACTATACTCGAGTATAGTAGATCCCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_018346.1-626s21c1
Sequence:CCGGGCGCGTGTCTGTAGACTTGATCTCGAGATCAAGTCTACAGACACGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_018346.1-905s21c1
Sequence:CCGGCAGTACCCACAATTGGACTTACTCGAGTAAGTCCAATTGTGGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_018346.1-502s21c1
Sequence:CCGGGGGTTAACAGGTTGTCTATAGCTCGAGCTATAGACAACCTGTTAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_018346.1-221s1c1
Sequence:CCGGCTGCAACTTCAACAAGTACATCTCGAGATGTACTTGTTGAAGTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018346.1-179s1c1
Sequence:CCGGGCTTTACGTACACTGGCCTTACTCGAGTAAGGCCAGTGTACGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_018346.1-905s1c1
Sequence:CCGGCAGTACCCACAATTGGACTTACTCGAGTAAGTCCAATTGTGGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018346.1-626s1c1
Sequence:CCGGGCGCGTGTCTGTAGACTTGATCTCGAGATCAAGTCTACAGACACGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018346.1-863s1c1
Sequence:CCGGCCACCAGTATGAGGTCTCCAACTCGAGTTGGAGACCTCATACTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018346
VALIDATED
RSAD1 MISSION shRNA Lentiviral Transduction Particles
radical S-adenosyl methionine domain containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_018346.1-221s21c1
Sequence:CCGGCTGCAACTTCAACAAGTACATCTCGAGATGTACTTGTTGAAGTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303395    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_018346.1-1805s21c1
Sequence:CCGGAGCAGGAAGGGATCTACTATACTCGAGTATAGTAGATCCCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_018346.1-626s21c1
Sequence:CCGGGCGCGTGTCTGTAGACTTGATCTCGAGATCAAGTCTACAGACACGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_018346.1-905s21c1
Sequence:CCGGCAGTACCCACAATTGGACTTACTCGAGTAAGTCCAATTGTGGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_018346.1-502s21c1
Sequence:CCGGGGGTTAACAGGTTGTCTATAGCTCGAGCTATAGACAACCTGTTAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_018346.1-221s1c1
Sequence:CCGGCTGCAACTTCAACAAGTACATCTCGAGATGTACTTGTTGAAGTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018346.1-179s1c1
Sequence:CCGGGCTTTACGTACACTGGCCTTACTCGAGTAAGGCCAGTGTACGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_018346.1-905s1c1
Sequence:CCGGCAGTACCCACAATTGGACTTACTCGAGTAAGTCCAATTGTGGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018346.1-626s1c1
Sequence:CCGGGCGCGTGTCTGTAGACTTGATCTCGAGATCAAGTCTACAGACACGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018346.1-863s1c1
Sequence:CCGGCCACCAGTATGAGGTCTCCAACTCGAGTTGGAGACCTCATACTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013381
VALIDATED
RSAD1 MISSION shRNA Bacterial Glycerol Stock
radical S-adenosyl methionine domain containing 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000198904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013381.1-891s1c1
Sequence:CCGGGCCAATATGAGGTCTCCAATTCTCGAGAATTGGAGACCTCATATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013381.1-349s1c1
Sequence:CCGGGAGAGTAGAGTCTGTGTTCTTCTCGAGAAGAACACAGACTCTACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013381.1-931s1c1
Sequence:CCGGCAGTACCCATAACTGGACGTACTCGAGTACGTCCAGTTATGGGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181238    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013381.1-1767s1c1
Sequence:CCGGCCTAGCTTGTATGGTTCAGTACTCGAGTACTGAACCATACAAGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013381
VALIDATED
RSAD1 MISSION shRNA shRNA Plasmid DNA
radical S-adenosyl methionine domain containing 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000198904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013381.1-891s1c1
Sequence:CCGGGCCAATATGAGGTCTCCAATTCTCGAGAATTGGAGACCTCATATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013381.1-349s1c1
Sequence:CCGGGAGAGTAGAGTCTGTGTTCTTCTCGAGAAGAACACAGACTCTACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013381.1-931s1c1
Sequence:CCGGCAGTACCCATAACTGGACGTACTCGAGTACGTCCAGTTATGGGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181238    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013381.1-1767s1c1
Sequence:CCGGCCTAGCTTGTATGGTTCAGTACTCGAGTACTGAACCATACAAGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013381
VALIDATED
RSAD1 MISSION shRNA Lentiviral Transduction Particles
radical S-adenosyl methionine domain containing 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000198904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013381.1-891s1c1
Sequence:CCGGGCCAATATGAGGTCTCCAATTCTCGAGAATTGGAGACCTCATATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013381.1-349s1c1
Sequence:CCGGGAGAGTAGAGTCTGTGTTCTTCTCGAGAAGAACACAGACTCTACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013381.1-931s1c1
Sequence:CCGGCAGTACCCATAACTGGACGTACTCGAGTACGTCCAGTTATGGGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181238    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001013381.1-1767s1c1
Sequence:CCGGCCTAGCTTGTATGGTTCAGTACTCGAGTACTGAACCATACAAGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks