EMAIL THIS PAGE TO A FRIEND

RSPH3

radial spoke 3 homolog (Chlamydomonas)

Synonyms: RSHL2 RSP3 dJ111C20.1
UniProtKB ID: Q86UC2, Q96LQ5, Q96LX2, Q9BX75
Gene ID:
Rat(361476) radial spoke 3 homolog (Chlamydomonas)
Zebrafish(562259) radial spoke head 3 homolog (Chlamydomonas)
chicken(421663) radial spoke 3 homolog (Chlamydomonas)
domestic cat(101096480) radial spoke 3 homolog (Chlamydomonas)
Horse(100059353) radial spoke 3 homolog (Chlamydomonas)
dog(484057) radial spoke 3 homolog (Chlamydomonas)
cow(533135) radial spoke 3 homolog (Chlamydomonas)
sheep(101110682) radial spoke 3 homolog (Chlamydomonas)
naked mole-rat(101720107) radial spoke 3 homolog (Chlamydomonas)
domestic guinea pig(100717457) radial spoke 3 homolog (Chlamydomonas)
30 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031924 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031924 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031924 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU095581 MISSION® esiRNA esiRNA human RSHL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031924 Rosetta Predictions human pricing
NM_001108463 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031924 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224413 predicted 1535
2 SASI_Hs01_00224414 predicted 938
3 SASI_Hs01_00224415 predicted 1948
4 SASI_Hs01_00224416 predicted 769
5 SASI_Hs01_00224417 predicted 730
6 SASI_Hs01_00224418 predicted 1798
7 SASI_Hs01_00224419 predicted 1742
8 SASI_Hs01_00224421 predicted 1741
9 SASI_Hs01_00224422 predicted 729
10 SASI_Hs02_00359063 predicted 1528
11 SASI_Hs01_00224420 predicted 1958
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108463 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238889 predicted 584
2 SASI_Rn02_00238890 predicted 512
3 SASI_Rn02_00238891 predicted 398
4 SASI_Rn02_00238892 predicted 613
5 SASI_Rn02_00238893 predicted 528
6 SASI_Rn02_00238894 predicted 544
7 SASI_Rn02_00238895 predicted 605
8 SASI_Rn02_00238896 predicted 669
9 SASI_Rn02_00238897 predicted 611
10 SASI_Rn02_00238898 predicted 400
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031924
RSPH3 MISSION shRNA Bacterial Glycerol Stock
radial spoke 3 homolog (Chlamydomonas)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031924.3-1262s1c1
Sequence:CCGGGCTGAAGTTCAACGACTTGAACTCGAGTTCAAGTCGTTGAACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122283    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031924.3-1259s1c1
Sequence:CCGGCGTGCTGAAGTTCAACGACTTCTCGAGAAGTCGTTGAACTTCAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031924.3-743s1c1
Sequence:CCGGCCTATGCATTATGGAAACATACTCGAGTATGTTTCCATAATGCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031924.3-1808s1c1
Sequence:CCGGGAACTCTTAGGGCAAGATGAACTCGAGTTCATCTTGCCCTAAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143222    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031924.3-1913s1c1
Sequence:CCGGGTCAGCAAGCAATCAGGTAATCTCGAGATTACCTGATTGCTTGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031924.3-1436s1c1
Sequence:CCGGCTCAGGGATAGTGGCTACTTTCTCGAGAAAGTAGCCACTATCCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031924.3-1232s1c1
Sequence:CCGGGAGTATGAAGAACTACGGAATCTCGAGATTCCGTAGTTCTTCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031924.3-983s1c1
Sequence:CCGGGCTGATCGCATAATAGAAGTTCTCGAGAACTTCTATTATGCGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031924.3-1108s1c1
Sequence:CCGGGCTCTTTGACTTTGATCTTGACTCGAGTCAAGATCAAAGTCAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031924
RSPH3 MISSION shRNA shRNA Plasmid DNA
radial spoke 3 homolog (Chlamydomonas)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031924.3-1262s1c1
Sequence:CCGGGCTGAAGTTCAACGACTTGAACTCGAGTTCAAGTCGTTGAACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122283    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031924.3-1259s1c1
Sequence:CCGGCGTGCTGAAGTTCAACGACTTCTCGAGAAGTCGTTGAACTTCAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031924.3-743s1c1
Sequence:CCGGCCTATGCATTATGGAAACATACTCGAGTATGTTTCCATAATGCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031924.3-1808s1c1
Sequence:CCGGGAACTCTTAGGGCAAGATGAACTCGAGTTCATCTTGCCCTAAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143222    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031924.3-1913s1c1
Sequence:CCGGGTCAGCAAGCAATCAGGTAATCTCGAGATTACCTGATTGCTTGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031924.3-1436s1c1
Sequence:CCGGCTCAGGGATAGTGGCTACTTTCTCGAGAAAGTAGCCACTATCCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031924.3-1232s1c1
Sequence:CCGGGAGTATGAAGAACTACGGAATCTCGAGATTCCGTAGTTCTTCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031924.3-983s1c1
Sequence:CCGGGCTGATCGCATAATAGAAGTTCTCGAGAACTTCTATTATGCGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031924.3-1108s1c1
Sequence:CCGGGCTCTTTGACTTTGATCTTGACTCGAGTCAAGATCAAAGTCAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031924
RSPH3 MISSION shRNA Lentiviral Transduction Particles
radial spoke 3 homolog (Chlamydomonas)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031924.3-1262s1c1
Sequence:CCGGGCTGAAGTTCAACGACTTGAACTCGAGTTCAAGTCGTTGAACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122283    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031924.3-1259s1c1
Sequence:CCGGCGTGCTGAAGTTCAACGACTTCTCGAGAAGTCGTTGAACTTCAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031924.3-743s1c1
Sequence:CCGGCCTATGCATTATGGAAACATACTCGAGTATGTTTCCATAATGCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031924.3-1808s1c1
Sequence:CCGGGAACTCTTAGGGCAAGATGAACTCGAGTTCATCTTGCCCTAAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143222    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031924.3-1913s1c1
Sequence:CCGGGTCAGCAAGCAATCAGGTAATCTCGAGATTACCTGATTGCTTGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031924.3-1436s1c1
Sequence:CCGGCTCAGGGATAGTGGCTACTTTCTCGAGAAAGTAGCCACTATCCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031924.3-1232s1c1
Sequence:CCGGGAGTATGAAGAACTACGGAATCTCGAGATTCCGTAGTTCTTCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031924.3-983s1c1
Sequence:CCGGGCTGATCGCATAATAGAAGTTCTCGAGAACTTCTATTATGCGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031924.3-1108s1c1
Sequence:CCGGGCTCTTTGACTTTGATCTTGACTCGAGTCAAGATCAAAGTCAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks