EMAIL THIS PAGE TO A FRIEND

RTEL1

regulator of telomere elongation helicase 1

Synonyms: C20orf41 DKCB5 NHL RTEL bK3184A7.3
Gene ID:
Human(51750) Summary: In mice, inactivation of the Rtel (regulator of telomere length) gene has been shown to cause chromosome breaks, fusions, and telomere loss. In addition, Rtel is required for telomere elongation. Therefore, the mouse Rtel gene regulates chromosome stability and telomere length. This gene is the human ortholog of the mouse Rtel gene, so its protein product may play similar roles in humans. Read-through transcription of this gene into the neighboring downstream gene, which encodes tumor necrosis factor receptor superfamily, member 6b, decoy (TNFRSF6B), generates a non-coding transcript. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2011]
Mouse(269400) regulator of telomere elongation helicase 1
Rat(362288) regulator of telomere elongation helicase 1
Zebrafish(503732) regulator of telomere elongation helicase 1
domestic cat(101095970) regulator of telomere elongation helicase 1
dog(485976) regulator of telomere elongation helicase 1
chicken(419262) regulator of telomere elongation helicase 1
naked mole-rat(101711246) regulator of telomere elongation helicase 1
domestic guinea pig(100716322) regulator of telomere elongation helicase 1
cow(505721) regulator of telomere elongation helicase 1
sheep(101117606) regulator of telomere elongation helicase 1
141 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA067329 Anti-RTEL1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016434 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016434 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016434 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001001882 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001001882 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001001882 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU157551 MISSION® esiRNA esiRNA human RTEL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016434 Rosetta Predictions human pricing
NM_032957 Rosetta Predictions human pricing
XM_001057789 Rosetta Predictions rat pricing
XM_342602 Rosetta Predictions rat pricing
NM_001001882 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016434 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013491 predicted 1593
2 SASI_Hs01_00013492 predicted 389
3 SASI_Hs01_00013493 predicted 794
4 SASI_Hs01_00013495 predicted 1516
5 SASI_Hs01_00013496 predicted 3692
6 SASI_Hs01_00013498 predicted 1408
7 SASI_Hs01_00013499 predicted 958
8 SASI_Hs01_00013500 predicted 1043
9 SASI_Hs02_00349461 predicted 3223
10 SASI_Hs02_00349462 predicted 1845
11 SASI_Hs01_00013494 predicted 2964
12 SASI_Hs01_00013497 predicted 1022
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032957 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044914 predicted 1595
2 SASI_Hs01_00044915 predicted 386
3 SASI_Hs01_00044916 predicted 786
4 SASI_Hs01_00044918 predicted 1515
5 SASI_Hs01_00044919 predicted 3691
6 SASI_Hs01_00044921 predicted 1401
7 SASI_Hs01_00044922 predicted 956
8 SASI_Hs01_00044923 predicted 1047
9 SASI_Hs02_00360579 predicted 3228
10 SASI_Hs02_00360580 predicted 1850
11 SASI_Hs01_00044917 predicted 2969
12 SASI_Hs01_00044920 predicted 1014
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057789 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00287571 predicted 2598
2 SASI_Rn02_00287572 predicted 3612
3 SASI_Rn02_00287573 predicted 3004
4 SASI_Rn02_00287574 predicted 590
5 SASI_Rn02_00287575 predicted 3673
6 SASI_Rn02_00287576 predicted 605
7 SASI_Rn02_00287577 predicted 1703
8 SASI_Rn02_00287578 predicted 2033
9 SASI_Rn02_00287579 predicted 3626
10 SASI_Rn02_00287580 predicted 890
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342602 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394530 predicted 2598
2 SASI_Rn02_00394531 predicted 3606
3 SASI_Rn02_00394532 predicted 3008
4 SASI_Rn02_00394533 predicted 595
5 SASI_Rn02_00394534 predicted 3672
6 SASI_Rn02_00394535 predicted 604
7 SASI_Rn02_00394536 predicted 1700
8 SASI_Rn02_00394537 predicted 2030
9 SASI_Rn02_00394538 predicted 3627
10 SASI_Rn02_00394539 predicted 886
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001882 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086141 predicted 526
2 SASI_Mm01_00086142 predicted 3526
3 SASI_Mm02_00286228 predicted 1786
4 SASI_Mm01_00086143 predicted 837
5 SASI_Mm01_00086144 predicted 2533
6 SASI_Mm01_00086146 predicted 538
7 SASI_Mm01_00086147 predicted 1392
8 SASI_Mm01_00086148 predicted 3047
9 SASI_Mm02_00286229 predicted 1319
10 SASI_Mm01_00086150 predicted 1480
11 SASI_Mm01_00086145 predicted 2125
12 SASI_Mm01_00086149 predicted 3583
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016434
VALIDATED
RTEL1 MISSION shRNA Bacterial Glycerol Stock
regulator of telomere elongation helicase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016434.2-1510s21c1
Sequence:CCGGGCAGAAGCTGGCGGACATTATCTCGAGATAATGTCCGCCAGCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016434.2-653s21c1
Sequence:CCGGACGGACATCCCAAAGATTATTCTCGAGAATAATCTTTGGGATGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016434.2-1161s21c1
Sequence:CCGGCTTCAGGACTGGACGTCATAGCTCGAGCTATGACGTCCAGTCCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016434.2-1006s21c1
Sequence:GTACCGGCATATTCATGCCGTACAATTACTCGAGTAATTGTACGGCATGAATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016434.2-4098s21c1
Sequence:CCGGACACCCAACGTGGCTTGATCACTCGAGTGATCAAGCCACGTTGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_016434.2-1016s1c1
Sequence:CCGGCCGTACAATTACTTGTTGGATCTCGAGATCCAACAAGTAATTGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016434.2-1000s1c1
Sequence:CCGGCGACATCATATTCATGCCGTACTCGAGTACGGCATGAATATGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016434.2-2536s1c1
Sequence:CCGGCGTCAGGGTGTATGACAACTTCTCGAGAAGTTGTCATACACCCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_016434.2-403s1c1
Sequence:CCGGCCAACAGGAGTACATGACCAACTCGAGTTGGTCATGTACTCCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_016434.2-2011s1c1
Sequence:CCGGCCTGATCTTCTTCCCTTCCTACTCGAGTAGGAAGGGAAGAAGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016434
VALIDATED
RTEL1 MISSION shRNA shRNA Plasmid DNA
regulator of telomere elongation helicase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016434.2-1510s21c1
Sequence:CCGGGCAGAAGCTGGCGGACATTATCTCGAGATAATGTCCGCCAGCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016434.2-653s21c1
Sequence:CCGGACGGACATCCCAAAGATTATTCTCGAGAATAATCTTTGGGATGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016434.2-1161s21c1
Sequence:CCGGCTTCAGGACTGGACGTCATAGCTCGAGCTATGACGTCCAGTCCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016434.2-1006s21c1
Sequence:GTACCGGCATATTCATGCCGTACAATTACTCGAGTAATTGTACGGCATGAATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016434.2-4098s21c1
Sequence:CCGGACACCCAACGTGGCTTGATCACTCGAGTGATCAAGCCACGTTGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_016434.2-1016s1c1
Sequence:CCGGCCGTACAATTACTTGTTGGATCTCGAGATCCAACAAGTAATTGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016434.2-1000s1c1
Sequence:CCGGCGACATCATATTCATGCCGTACTCGAGTACGGCATGAATATGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016434.2-2536s1c1
Sequence:CCGGCGTCAGGGTGTATGACAACTTCTCGAGAAGTTGTCATACACCCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_016434.2-403s1c1
Sequence:CCGGCCAACAGGAGTACATGACCAACTCGAGTTGGTCATGTACTCCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_016434.2-2011s1c1
Sequence:CCGGCCTGATCTTCTTCCCTTCCTACTCGAGTAGGAAGGGAAGAAGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016434
VALIDATED
RTEL1 MISSION shRNA Lentiviral Transduction Particles
regulator of telomere elongation helicase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016434.2-1510s21c1
Sequence:CCGGGCAGAAGCTGGCGGACATTATCTCGAGATAATGTCCGCCAGCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016434.2-653s21c1
Sequence:CCGGACGGACATCCCAAAGATTATTCTCGAGAATAATCTTTGGGATGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016434.2-1161s21c1
Sequence:CCGGCTTCAGGACTGGACGTCATAGCTCGAGCTATGACGTCCAGTCCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016434.2-1006s21c1
Sequence:GTACCGGCATATTCATGCCGTACAATTACTCGAGTAATTGTACGGCATGAATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016434.2-4098s21c1
Sequence:CCGGACACCCAACGTGGCTTGATCACTCGAGTGATCAAGCCACGTTGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_016434.2-1016s1c1
Sequence:CCGGCCGTACAATTACTTGTTGGATCTCGAGATCCAACAAGTAATTGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016434.2-1000s1c1
Sequence:CCGGCGACATCATATTCATGCCGTACTCGAGTACGGCATGAATATGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016434.2-2536s1c1
Sequence:CCGGCGTCAGGGTGTATGACAACTTCTCGAGAAGTTGTCATACACCCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_016434.2-403s1c1
Sequence:CCGGCCAACAGGAGTACATGACCAACTCGAGTTGGTCATGTACTCCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_016434.2-2011s1c1
Sequence:CCGGCCTGATCTTCTTCCCTTCCTACTCGAGTAGGAAGGGAAGAAGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001882
VALIDATED
RTEL1 MISSION shRNA Bacterial Glycerol Stock
regulator of telomere elongation helicase 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000075328    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001882.2-3859s1c1
Sequence:CCGGCAGTGAATGTTGGTTATGGTACTCGAGTACCATAACCAACATTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001882.2-2415s1c1
Sequence:CCGGCCTTAAGGTGTATGACAACTTCTCGAGAAGTTGTCATACACCTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001882.2-2299s1c1
Sequence:CCGGCAGGCTATTGGGAGGGTTATTCTCGAGAATAACCCTCCCAATAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001882.2-2157s1c1
Sequence:CCGGCCTCCCATATCCTCCACGCATCTCGAGATGCGTGGAGGATATGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001882
VALIDATED
RTEL1 MISSION shRNA shRNA Plasmid DNA
regulator of telomere elongation helicase 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000075328    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001882.2-3859s1c1
Sequence:CCGGCAGTGAATGTTGGTTATGGTACTCGAGTACCATAACCAACATTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001882.2-2415s1c1
Sequence:CCGGCCTTAAGGTGTATGACAACTTCTCGAGAAGTTGTCATACACCTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001882.2-2299s1c1
Sequence:CCGGCAGGCTATTGGGAGGGTTATTCTCGAGAATAACCCTCCCAATAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001882.2-2157s1c1
Sequence:CCGGCCTCCCATATCCTCCACGCATCTCGAGATGCGTGGAGGATATGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001882
VALIDATED
RTEL1 MISSION shRNA Lentiviral Transduction Particles
regulator of telomere elongation helicase 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000075328    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001882.2-3859s1c1
Sequence:CCGGCAGTGAATGTTGGTTATGGTACTCGAGTACCATAACCAACATTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001882.2-2415s1c1
Sequence:CCGGCCTTAAGGTGTATGACAACTTCTCGAGAAGTTGTCATACACCTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001882.2-2299s1c1
Sequence:CCGGCAGGCTATTGGGAGGGTTATTCTCGAGAATAACCCTCCCAATAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001882.2-2157s1c1
Sequence:CCGGCCTCCCATATCCTCCACGCATCTCGAGATGCGTGGAGGATATGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks