EMAIL THIS PAGE TO A FRIEND

RTF1

Rtf1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)

Synonyms: GTL7 KIAA0252
UniProtKB ID: Q92541, Q96BX6
Gene ID:
Human(23168) Summary: This locus may represent a gene involved in regulation of transcription elongation and chromatin remodeling, based on studies of similar proteins in other organisms. The encoded protein may bind single-stranded DNA. [provided by RefSeq, Sep 2010]
Mouse(76246) Rtf1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
Rat(366169) Rtf1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
fruit fly(37554) CG10955 gene product from transcript CG10955-RA
Horse(100071156) Rtf1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
domestic cat(101084970) Rtf1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
dog(487506) Rtf1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
chicken(423215) Rtf1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
Zebrafish(100000471) Rtf1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
cow(518260) Rtf1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
sheep(101113595) Rtf1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
domestic guinea pig(100732871) Rtf1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
naked mole-rat(101698179) Rtf1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
Domestic Rabbit(100347265) Rtf1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
243 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015138 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015138 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015138 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030112 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030112 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030112 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015138 Rosetta Predictions human pricing
NM_001108958 Rosetta Predictions rat pricing
NM_030112 Rosetta Predictions mouse pricing
XM_283757 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015138 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055522 predicted 1308
2 SASI_Hs01_00055524 predicted 1801
3 SASI_Hs01_00055526 predicted 1394
4 SASI_Hs02_00347066 predicted 1587
5 SASI_Hs01_00055527 predicted 1428
6 SASI_Hs01_00055528 predicted 1702
7 SASI_Hs01_00055529 predicted 1200
8 SASI_Hs01_00055530 predicted 1099
9 SASI_Hs01_00055531 predicted 1889
10 SASI_Hs02_00347067 predicted 2015
11 SASI_Hs01_00055523 predicted 1658
12 SASI_Hs01_00055525 predicted 1306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108958 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243764 predicted 891
2 SASI_Rn02_00243765 predicted 1311
3 SASI_Rn02_00243766 predicted 1789
4 SASI_Rn02_00243767 predicted 2036
5 SASI_Rn02_00243768 predicted 1606
6 SASI_Rn02_00243769 predicted 1208
7 SASI_Rn02_00243770 predicted 1172
8 SASI_Rn02_00243771 predicted 1164
9 SASI_Rn02_00243772 predicted 1788
10 SASI_Rn02_00243773 predicted 1635
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030112 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336496 predicted 1721
2 SASI_Mm02_00336497 predicted 1459
3 SASI_Mm02_00336498 predicted 319
4 SASI_Mm02_00336499 predicted 1555
5 SASI_Mm02_00336500 predicted 325
6 SASI_Mm02_00336501 predicted 1356
7 SASI_Mm02_00336502 predicted 1529
8 SASI_Mm02_00336503 predicted 1412
9 SASI_Mm02_00336504 predicted 1607
10 SASI_Mm02_00336505 predicted 1933
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_283757 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00207950 predicted 1727
2 SASI_Mm01_00207951 predicted 1456
3 SASI_Mm01_00207952 predicted 325
4 SASI_Mm01_00207953 predicted 1566
5 SASI_Mm01_00207954 predicted 1945
6 SASI_Mm01_00207955 predicted 329
7 SASI_Mm01_00207956 predicted 1357
8 SASI_Mm01_00207957 predicted 1423
9 SASI_Mm01_00207958 predicted 1543
10 SASI_Mm01_00207959 predicted 1944
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015138
VALIDATED
RTF1 MISSION shRNA Bacterial Glycerol Stock
Rtf1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015138.2-4108s1c1
Sequence:CCGGCCGAAACTCTTTATAGACTATCTCGAGATAGTCTATAAAGAGTTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015138.2-1703s1c1
Sequence:CCGGGCTGAAAGTCACAACATGAAACTCGAGTTTCATGTTGTGACTTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015138.2-577s1c1
Sequence:CCGGGCAAGAACTGTTCAATCGCATCTCGAGATGCGATTGAACAGTTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_015138.2-1273s1c1
Sequence:CCGGCCGTTTAGAGTTTGTCTCAAACTCGAGTTTGAGACAAACTCTAAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_015138.2-1556s1c1
Sequence:CCGGGCCAAACAAATCCAAGATCAACTCGAGTTGATCTTGGATTTGTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015138.4-1096s21c1
Sequence:CCGGGTTCGATTATCACGGCATAAGCTCGAGCTTATGCCGTGATAATCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426881    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015138.4-2246s21c1
Sequence:CCGGGAACTGGGAAGAGACTCTAAACTCGAGTTTAGAGTCTCTTCCCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015138
VALIDATED
RTF1 MISSION shRNA shRNA Plasmid DNA
Rtf1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015138.2-4108s1c1
Sequence:CCGGCCGAAACTCTTTATAGACTATCTCGAGATAGTCTATAAAGAGTTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015138.2-1703s1c1
Sequence:CCGGGCTGAAAGTCACAACATGAAACTCGAGTTTCATGTTGTGACTTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015138.2-577s1c1
Sequence:CCGGGCAAGAACTGTTCAATCGCATCTCGAGATGCGATTGAACAGTTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_015138.2-1273s1c1
Sequence:CCGGCCGTTTAGAGTTTGTCTCAAACTCGAGTTTGAGACAAACTCTAAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_015138.2-1556s1c1
Sequence:CCGGGCCAAACAAATCCAAGATCAACTCGAGTTGATCTTGGATTTGTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015138.4-1096s21c1
Sequence:CCGGGTTCGATTATCACGGCATAAGCTCGAGCTTATGCCGTGATAATCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426881    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015138.4-2246s21c1
Sequence:CCGGGAACTGGGAAGAGACTCTAAACTCGAGTTTAGAGTCTCTTCCCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015138
VALIDATED
RTF1 MISSION shRNA Lentiviral Transduction Particles
Rtf1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015138.2-4108s1c1
Sequence:CCGGCCGAAACTCTTTATAGACTATCTCGAGATAGTCTATAAAGAGTTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015138.2-1703s1c1
Sequence:CCGGGCTGAAAGTCACAACATGAAACTCGAGTTTCATGTTGTGACTTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015138.2-577s1c1
Sequence:CCGGGCAAGAACTGTTCAATCGCATCTCGAGATGCGATTGAACAGTTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_015138.2-1273s1c1
Sequence:CCGGCCGTTTAGAGTTTGTCTCAAACTCGAGTTTGAGACAAACTCTAAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_015138.2-1556s1c1
Sequence:CCGGGCCAAACAAATCCAAGATCAACTCGAGTTGATCTTGGATTTGTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015138.4-1096s21c1
Sequence:CCGGGTTCGATTATCACGGCATAAGCTCGAGCTTATGCCGTGATAATCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426881    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015138.4-2246s21c1
Sequence:CCGGGAACTGGGAAGAGACTCTAAACTCGAGTTTAGAGTCTCTTCCCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030112
VALIDATED
RTF1 MISSION shRNA Bacterial Glycerol Stock
Rtf1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030112.1-1087s21c1
Sequence:CCGGGTTCGGTTATCACGGCATAAGCTCGAGCTTATGCCGTGATAACCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030112.1-1700s21c1
Sequence:CCGGGGAATCGGGAGTGGAATATTGCTCGAGCAATATTCCACTCCCGATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030112.1-543s21c1
Sequence:CCGGTGGCTATGGAGAGGATCTTATCTCGAGATAAGATCCTCTCCATAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241452    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030112.1-2149s21c1
Sequence:CCGGTGCTGCTTCCAACCCTGCATGCTCGAGCATGCAGGGTTGGAAGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030112.1-1440s21c1
Sequence:CCGGTAAGGAAGCTCTCAATTATAACTCGAGTTATAATTGAGAGCTTCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030112
VALIDATED
RTF1 MISSION shRNA shRNA Plasmid DNA
Rtf1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030112.1-1087s21c1
Sequence:CCGGGTTCGGTTATCACGGCATAAGCTCGAGCTTATGCCGTGATAACCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030112.1-1700s21c1
Sequence:CCGGGGAATCGGGAGTGGAATATTGCTCGAGCAATATTCCACTCCCGATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030112.1-543s21c1
Sequence:CCGGTGGCTATGGAGAGGATCTTATCTCGAGATAAGATCCTCTCCATAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241452    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030112.1-2149s21c1
Sequence:CCGGTGCTGCTTCCAACCCTGCATGCTCGAGCATGCAGGGTTGGAAGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030112.1-1440s21c1
Sequence:CCGGTAAGGAAGCTCTCAATTATAACTCGAGTTATAATTGAGAGCTTCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030112
VALIDATED
RTF1 MISSION shRNA Lentiviral Transduction Particles
Rtf1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030112.1-1087s21c1
Sequence:CCGGGTTCGGTTATCACGGCATAAGCTCGAGCTTATGCCGTGATAACCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030112.1-1700s21c1
Sequence:CCGGGGAATCGGGAGTGGAATATTGCTCGAGCAATATTCCACTCCCGATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030112.1-543s21c1
Sequence:CCGGTGGCTATGGAGAGGATCTTATCTCGAGATAAGATCCTCTCCATAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241452    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030112.1-2149s21c1
Sequence:CCGGTGCTGCTTCCAACCCTGCATGCTCGAGCATGCAGGGTTGGAAGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030112.1-1440s21c1
Sequence:CCGGTAAGGAAGCTCTCAATTATAACTCGAGTTATAATTGAGAGCTTCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks