EMAIL THIS PAGE TO A FRIEND

RTN1

reticulon 1

Synonyms: NSP
UniProtKB ID: Q16799, Q16800, Q16801, Q5BKZ4, Q9BQ59
Gene ID:
Human(6252) Summary: This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. This gene is considered to be a specific marker for neurological diseases and cancer, and is a potential molecular target for therapy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2011]
Mouse(104001) reticulon 1
Rat(116644) reticulon 1
chicken(378791) reticulon 1
dog(474178) reticulon 1
cow(532565) reticulon 1
160 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021136 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021136 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021136 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153457 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153457 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153457 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU072311 MISSION® esiRNA esiRNA human RTN1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021136 Rosetta Predictions human pricing
NM_206852 Rosetta Predictions human pricing
NM_206857 Rosetta Predictions human pricing
NM_053865 Rosetta Predictions rat pricing
NM_001007596 Rosetta Predictions mouse pricing
NM_153457 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021136 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195333 predicted 2725
2 SASI_Hs01_00195334 predicted 2591
3 SASI_Hs01_00195335 predicted 2578
4 SASI_Hs01_00195336 predicted 2708
5 SASI_Hs01_00195337 predicted 2793
6 SASI_Hs01_00195339 predicted 2442
7 SASI_Hs01_00195340 predicted 2956
8 SASI_Hs01_00195341 predicted 2926
9 SASI_Hs01_00195342 predicted 2979
10 SASI_Hs02_00354659 predicted 2511
11 SASI_Hs01_00195338 predicted 2850
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206852 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207021 predicted 1107
2 SASI_Hs01_00207022 predicted 976
3 SASI_Hs01_00207023 predicted 966
4 SASI_Hs01_00207024 predicted 1092
5 SASI_Hs01_00207025 predicted 1175
6 SASI_Hs01_00207027 predicted 825
7 SASI_Hs01_00207028 predicted 1337
8 SASI_Hs01_00207029 predicted 1303
9 SASI_Hs01_00207030 predicted 1359
10 SASI_Hs02_00373570 predicted 895
11 SASI_Hs01_00207026 predicted 1239
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206857 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164817 predicted 1550
2 SASI_Hs01_00164818 predicted 1413
3 SASI_Hs01_00164819 predicted 1404
4 SASI_Hs01_00164820 predicted 1537
5 SASI_Hs01_00164821 predicted 1609
6 SASI_Hs01_00164823 predicted 1267
7 SASI_Hs01_00164824 predicted 1772
8 SASI_Hs01_00164825 predicted 1750
9 SASI_Hs01_00164826 predicted 1793
10 SASI_Hs02_00373571 predicted 1332
11 SASI_Hs01_00164822 predicted 1677
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053865 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039398 predicted 2659
2 SASI_Rn01_00039399 predicted 885
3 SASI_Rn01_00039400 predicted 1462
4 SASI_Rn01_00039401 predicted 714
5 SASI_Rn01_00039403 predicted 2321
6 SASI_Rn01_00039404 predicted 2650
7 SASI_Rn02_00266740 predicted 2358
8 SASI_Rn01_00039405 predicted 2575
9 SASI_Rn01_00039406 predicted 2108
10 SASI_Rn02_00266741 predicted 2175
11 SASI_Rn01_00039397 predicted 2336
12 SASI_Rn01_00039402 predicted 2676
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007596 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036520 predicted 676
2 SASI_Mm01_00036521 predicted 625
3 SASI_Mm01_00036522 predicted 737
4 SASI_Mm01_00036524 predicted 611
5 SASI_Mm01_00036525 predicted 668
6 SASI_Mm01_00036526 predicted 651
7 SASI_Mm01_00036527 predicted 598
8 SASI_Mm02_00286766 predicted 568
9 SASI_Mm01_00036528 predicted 690
10 SASI_Mm02_00286767 predicted 1211
11 SASI_Mm01_00036523 predicted 716
12 SASI_Mm01_00036529 predicted 1202
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153457 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201070 predicted 2649
2 SASI_Mm01_00201071 predicted 2598
3 SASI_Mm01_00201072 predicted 2703
4 SASI_Mm01_00201074 predicted 2586
5 SASI_Mm01_00201075 predicted 2632
6 SASI_Mm01_00201076 predicted 2625
7 SASI_Mm01_00201077 predicted 2571
8 SASI_Mm02_00343228 predicted 2536
9 SASI_Mm01_00201078 predicted 2661
10 SASI_Mm01_00201079 predicted 873
11 SASI_Mm01_00201073 predicted 2676
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021136
RTN1 MISSION shRNA Bacterial Glycerol Stock
reticulon 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021136.2-885s21c1
Sequence:CCGGGACACTGACATCTCAATTAAACTCGAGTTTAATTGAGATGTCAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021136.2-2521s21c1
Sequence:CCGGCTAAGAGGCACGCTGAGTAAACTCGAGTTTACTCAGCGTGCCTCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021136.2-3009s21c1
Sequence:CCGGTTCCAACACACACAACGTAAACTCGAGTTTACGTTGTGTGTGTTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021136.2-684s1c1
Sequence:CCGGCGTGGCTTATTTAGTTCTGATCTCGAGATCAGAACTAAATAAGCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179231    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021136.2-2907s1c1
Sequence:CCGGGCTCTGATGCAATAGTGGAAACTCGAGTTTCCACTATTGCATCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021136.2-1296s1c1
Sequence:CCGGGCAAAGGGATTATCGTATGAACTCGAGTTCATACGATAATCCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021136.2-517s1c1
Sequence:CCGGCGTGTTACACATCTCTCATTTCTCGAGAAATGAGAGATGTGTAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021136
RTN1 MISSION shRNA shRNA Plasmid DNA
reticulon 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021136.2-885s21c1
Sequence:CCGGGACACTGACATCTCAATTAAACTCGAGTTTAATTGAGATGTCAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021136.2-2521s21c1
Sequence:CCGGCTAAGAGGCACGCTGAGTAAACTCGAGTTTACTCAGCGTGCCTCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021136.2-3009s21c1
Sequence:CCGGTTCCAACACACACAACGTAAACTCGAGTTTACGTTGTGTGTGTTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021136.2-684s1c1
Sequence:CCGGCGTGGCTTATTTAGTTCTGATCTCGAGATCAGAACTAAATAAGCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179231    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021136.2-2907s1c1
Sequence:CCGGGCTCTGATGCAATAGTGGAAACTCGAGTTTCCACTATTGCATCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021136.2-1296s1c1
Sequence:CCGGGCAAAGGGATTATCGTATGAACTCGAGTTCATACGATAATCCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021136.2-517s1c1
Sequence:CCGGCGTGTTACACATCTCTCATTTCTCGAGAAATGAGAGATGTGTAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021136
RTN1 MISSION shRNA Lentiviral Transduction Particles
reticulon 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021136.2-885s21c1
Sequence:CCGGGACACTGACATCTCAATTAAACTCGAGTTTAATTGAGATGTCAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021136.2-2521s21c1
Sequence:CCGGCTAAGAGGCACGCTGAGTAAACTCGAGTTTACTCAGCGTGCCTCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021136.2-3009s21c1
Sequence:CCGGTTCCAACACACACAACGTAAACTCGAGTTTACGTTGTGTGTGTTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021136.2-684s1c1
Sequence:CCGGCGTGGCTTATTTAGTTCTGATCTCGAGATCAGAACTAAATAAGCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179231    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021136.2-2907s1c1
Sequence:CCGGGCTCTGATGCAATAGTGGAAACTCGAGTTTCCACTATTGCATCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021136.2-1296s1c1
Sequence:CCGGGCAAAGGGATTATCGTATGAACTCGAGTTCATACGATAATCCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021136.2-517s1c1
Sequence:CCGGCGTGTTACACATCTCTCATTTCTCGAGAAATGAGAGATGTGTAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153457
RTN1 MISSION shRNA Bacterial Glycerol Stock
reticulon 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119367    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153457.6-2806s1c1
Sequence:CCGGGCAAATTGATTGTTTCCCTTTCTCGAGAAAGGGAAACAATCAATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153457.6-2315s1c1
Sequence:CCGGCGCATCTACAAGTCCGTTCTACTCGAGTAGAACGGACTTGTAGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153457.6-1448s1c1
Sequence:CCGGGATGAGTTGATTGCTGCCATTCTCGAGAATGGCAGCAATCAACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153457.6-2681s1c1
Sequence:CCGGGTGGCAAAGATCCAGGCTAAACTCGAGTTTAGCCTGGATCTTTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153457.6-959s1c1
Sequence:CCGGGCAGAAGCCTACAAATACATTCTCGAGAATGTATTTGTAGGCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153457
RTN1 MISSION shRNA shRNA Plasmid DNA
reticulon 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119367    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153457.6-2806s1c1
Sequence:CCGGGCAAATTGATTGTTTCCCTTTCTCGAGAAAGGGAAACAATCAATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153457.6-2315s1c1
Sequence:CCGGCGCATCTACAAGTCCGTTCTACTCGAGTAGAACGGACTTGTAGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153457.6-1448s1c1
Sequence:CCGGGATGAGTTGATTGCTGCCATTCTCGAGAATGGCAGCAATCAACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153457.6-2681s1c1
Sequence:CCGGGTGGCAAAGATCCAGGCTAAACTCGAGTTTAGCCTGGATCTTTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153457.6-959s1c1
Sequence:CCGGGCAGAAGCCTACAAATACATTCTCGAGAATGTATTTGTAGGCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153457
RTN1 MISSION shRNA Lentiviral Transduction Particles
reticulon 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119367    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153457.6-2806s1c1
Sequence:CCGGGCAAATTGATTGTTTCCCTTTCTCGAGAAAGGGAAACAATCAATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153457.6-2315s1c1
Sequence:CCGGCGCATCTACAAGTCCGTTCTACTCGAGTAGAACGGACTTGTAGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153457.6-1448s1c1
Sequence:CCGGGATGAGTTGATTGCTGCCATTCTCGAGAATGGCAGCAATCAACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153457.6-2681s1c1
Sequence:CCGGGTGGCAAAGATCCAGGCTAAACTCGAGTTTAGCCTGGATCTTTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153457.6-959s1c1
Sequence:CCGGGCAGAAGCCTACAAATACATTCTCGAGAATGTATTTGTAGGCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks