EMAIL THIS PAGE TO A FRIEND

RTP3

receptor (chemosensory) transporter protein 3

Synonyms: LTM1 TMEM7
UniProtKB ID: Q9BQQ7, A2RRP6
Gene ID:
Mouse(235636) receptor transporter protein 3
Rat(316018) receptor (chemosensory) transporter protein 3
cow(618086) receptor (chemosensory) transporter protein 3
sheep(101103516) receptor (chemosensory) transporter protein 3
naked mole-rat(101721977) receptor (chemosensory) transporter protein 3
domestic guinea pig(100719723) receptor (chemosensory) transporter protein 3
dog(609398) receptor (chemosensory) transporter protein 3
domestic cat(101093755) receptor (chemosensory) transporter protein 3
41 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1304357 ANTI-RTP3 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153100 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153100 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153100 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031440 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031440 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031440 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU155271 MISSION® esiRNA esiRNA human RTP3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031440 Rosetta Predictions human pricing
NM_001108190 Rosetta Predictions rat pricing
NM_153100 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031440 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239943 predicted 431
2 SASI_Hs01_00239944 predicted 322
3 SASI_Hs01_00239945 predicted 500
4 SASI_Hs01_00239946 predicted 447
5 SASI_Hs02_00358851 predicted 413
6 SASI_Hs01_00239947 predicted 489
7 SASI_Hs01_00239948 predicted 358
8 SASI_Hs01_00239949 predicted 429
9 SASI_Hs01_00239950 predicted 438
10 SASI_Hs01_00239951 predicted 459
11 SASI_Hs01_00239942 predicted 384
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108190 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236214 predicted 430
2 SASI_Rn02_00236215 predicted 386
3 SASI_Rn02_00236216 predicted 417
4 SASI_Rn02_00236217 predicted 786
5 SASI_Rn02_00236218 predicted 453
6 SASI_Rn02_00236219 predicted 562
7 SASI_Rn02_00236220 predicted 378
8 SASI_Rn02_00236221 predicted 775
9 SASI_Rn02_00236222 predicted 789
10 SASI_Rn02_00236223 predicted 788
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153100 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044566 predicted 1060
2 SASI_Mm01_00044567 predicted 436
3 SASI_Mm01_00044568 predicted 479
4 SASI_Mm01_00044569 predicted 1493
5 SASI_Mm01_00044570 predicted 511
6 SASI_Mm01_00044571 predicted 1526
7 SASI_Mm01_00044572 predicted 790
8 SASI_Mm01_00044573 predicted 607
9 SASI_Mm01_00044574 predicted 1414
10 SASI_Mm01_00044575 predicted 419
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153100
RTP3 MISSION shRNA Bacterial Glycerol Stock
receptor (chemosensory) transporter protein 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153100.1-1502s21c1
Sequence:CCGGTCTTATTGCTGTGGTATTTATCTCGAGATAAATACCACAGCAATAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249010    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153100.1-2181s21c1
Sequence:CCGGGAACGTTTCCTTGTCGTTATTCTCGAGAATAACGACAAGGAAACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153100.1-478s21c1
Sequence:CCGGATTCTGAAGAAGTGCTATAAACTCGAGTTTATAGCACTTCTTCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153100.1-1287s21c1
Sequence:CCGGCTCAGTTATTGTGCCCATTTCCTCGAGGAAATGGGCACAATAACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153100.1-1065s21c1
Sequence:CCGGCCCTACATGTGTCATTCAAATCTCGAGATTTGAATGACACATGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153100.1-980s1c1
Sequence:CCGGCCAAGATTAGCTGTACCTCAACTCGAGTTGAGGTACAGCTAATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174384    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153100.1-1627s1c1
Sequence:CCGGCCTTTATGTGAAAGGTCAATACTCGAGTATTGACCTTTCACATAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193483    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153100.1-1500s1c1
Sequence:CCGGGTTCTTATTGCTGTGGTATTTCTCGAGAAATACCACAGCAATAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153100
RTP3 MISSION shRNA shRNA Plasmid DNA
receptor (chemosensory) transporter protein 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153100.1-1502s21c1
Sequence:CCGGTCTTATTGCTGTGGTATTTATCTCGAGATAAATACCACAGCAATAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249010    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153100.1-2181s21c1
Sequence:CCGGGAACGTTTCCTTGTCGTTATTCTCGAGAATAACGACAAGGAAACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153100.1-478s21c1
Sequence:CCGGATTCTGAAGAAGTGCTATAAACTCGAGTTTATAGCACTTCTTCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153100.1-1287s21c1
Sequence:CCGGCTCAGTTATTGTGCCCATTTCCTCGAGGAAATGGGCACAATAACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153100.1-1065s21c1
Sequence:CCGGCCCTACATGTGTCATTCAAATCTCGAGATTTGAATGACACATGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153100.1-980s1c1
Sequence:CCGGCCAAGATTAGCTGTACCTCAACTCGAGTTGAGGTACAGCTAATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174384    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153100.1-1627s1c1
Sequence:CCGGCCTTTATGTGAAAGGTCAATACTCGAGTATTGACCTTTCACATAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193483    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153100.1-1500s1c1
Sequence:CCGGGTTCTTATTGCTGTGGTATTTCTCGAGAAATACCACAGCAATAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153100
RTP3 MISSION shRNA Lentiviral Transduction Particles
receptor (chemosensory) transporter protein 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153100.1-1502s21c1
Sequence:CCGGTCTTATTGCTGTGGTATTTATCTCGAGATAAATACCACAGCAATAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249010    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153100.1-2181s21c1
Sequence:CCGGGAACGTTTCCTTGTCGTTATTCTCGAGAATAACGACAAGGAAACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153100.1-478s21c1
Sequence:CCGGATTCTGAAGAAGTGCTATAAACTCGAGTTTATAGCACTTCTTCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153100.1-1287s21c1
Sequence:CCGGCTCAGTTATTGTGCCCATTTCCTCGAGGAAATGGGCACAATAACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153100.1-1065s21c1
Sequence:CCGGCCCTACATGTGTCATTCAAATCTCGAGATTTGAATGACACATGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153100.1-980s1c1
Sequence:CCGGCCAAGATTAGCTGTACCTCAACTCGAGTTGAGGTACAGCTAATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174384    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153100.1-1627s1c1
Sequence:CCGGCCTTTATGTGAAAGGTCAATACTCGAGTATTGACCTTTCACATAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193483    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153100.1-1500s1c1
Sequence:CCGGGTTCTTATTGCTGTGGTATTTCTCGAGAAATACCACAGCAATAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031440
RTP3 MISSION shRNA Bacterial Glycerol Stock
receptor (chemosensory) transporter protein 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031440.1-510s1c1
Sequence:CCGGCCACACAATAGTGACAACTGTCTCGAGACAGTTGTCACTATTGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031440.1-480s1c1
Sequence:CCGGCCTATGATCAAGGACATCTCTCTCGAGAGAGATGTCCTTGATCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031440.1-332s1c1
Sequence:CCGGGTTTACCCAGAGATGTAAGAACTCGAGTTCTTACATCTCTGGGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031440.1-598s1c1
Sequence:CCGGCAAGAGTACACTCCATTTACACTCGAGTGTAAATGGAGTGTACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031440.1-654s1c1
Sequence:CCGGGAGAATGTCTATTCCTACGCACTCGAGTGCGTAGGAATAGACATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031440.1-395s1c1
Sequence:CCGGGAACATCTCAAGGATCCTGAACTCGAGTTCAGGATCCTTGAGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158198    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031440.1-315s1c1
Sequence:CCGGCAGGTGAAGATGAGGGTGTTTCTCGAGAAACACCCTCATCTTCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031440.1-377s1c1
Sequence:CCGGCCCTGAGTTCACACAAGAGAACTCGAGTTCTCTTGTGTGAACTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031440.1-462s1c1
Sequence:CCGGCAGTTGATAGAGGAGGTTCCTCTCGAGAGGAACCTCCTCTATCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031440
RTP3 MISSION shRNA shRNA Plasmid DNA
receptor (chemosensory) transporter protein 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031440.1-510s1c1
Sequence:CCGGCCACACAATAGTGACAACTGTCTCGAGACAGTTGTCACTATTGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031440.1-480s1c1
Sequence:CCGGCCTATGATCAAGGACATCTCTCTCGAGAGAGATGTCCTTGATCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031440.1-332s1c1
Sequence:CCGGGTTTACCCAGAGATGTAAGAACTCGAGTTCTTACATCTCTGGGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031440.1-598s1c1
Sequence:CCGGCAAGAGTACACTCCATTTACACTCGAGTGTAAATGGAGTGTACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031440.1-654s1c1
Sequence:CCGGGAGAATGTCTATTCCTACGCACTCGAGTGCGTAGGAATAGACATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031440.1-395s1c1
Sequence:CCGGGAACATCTCAAGGATCCTGAACTCGAGTTCAGGATCCTTGAGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158198    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031440.1-315s1c1
Sequence:CCGGCAGGTGAAGATGAGGGTGTTTCTCGAGAAACACCCTCATCTTCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031440.1-377s1c1
Sequence:CCGGCCCTGAGTTCACACAAGAGAACTCGAGTTCTCTTGTGTGAACTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031440.1-462s1c1
Sequence:CCGGCAGTTGATAGAGGAGGTTCCTCTCGAGAGGAACCTCCTCTATCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031440
RTP3 MISSION shRNA Lentiviral Transduction Particles
receptor (chemosensory) transporter protein 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031440.1-510s1c1
Sequence:CCGGCCACACAATAGTGACAACTGTCTCGAGACAGTTGTCACTATTGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031440.1-480s1c1
Sequence:CCGGCCTATGATCAAGGACATCTCTCTCGAGAGAGATGTCCTTGATCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031440.1-332s1c1
Sequence:CCGGGTTTACCCAGAGATGTAAGAACTCGAGTTCTTACATCTCTGGGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031440.1-598s1c1
Sequence:CCGGCAAGAGTACACTCCATTTACACTCGAGTGTAAATGGAGTGTACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031440.1-654s1c1
Sequence:CCGGGAGAATGTCTATTCCTACGCACTCGAGTGCGTAGGAATAGACATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031440.1-395s1c1
Sequence:CCGGGAACATCTCAAGGATCCTGAACTCGAGTTCAGGATCCTTGAGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158198    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031440.1-315s1c1
Sequence:CCGGCAGGTGAAGATGAGGGTGTTTCTCGAGAAACACCCTCATCTTCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031440.1-377s1c1
Sequence:CCGGCCCTGAGTTCACACAAGAGAACTCGAGTTCTCTTGTGTGAACTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031440.1-462s1c1
Sequence:CCGGCAGTTGATAGAGGAGGTTCCTCTCGAGAGGAACCTCCTCTATCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks