EMAIL THIS PAGE TO A FRIEND

RUFY1

RUN and FYVE domain containing 1

Synonyms: RABIP4 ZFYVE12
UniProtKB ID: Q96T51, Q59FF3, Q71S93, Q9H6I3
Gene ID:
Human(80230) Summary: This gene encodes a protein that contains a RUN domain and a FYVE-type zinc finger domain. The encoded protein binds to phosphatidylinositol-3-phosphate (PI3P) and plays a role in early endosomal trafficking, tethering and fusion through interactions with small GTPases including Rab4, Rab5 and Rab14. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Mouse(216724) RUN and FYVE domain containing 1
Rat(360521) RUN and FYVE domain containing 1
cow(528153) RUN and FYVE domain containing 1
sheep(101122780) RUN and FYVE domain containing 1
Domestic Rabbit(100341127) RUN and FYVE domain containing 1
naked mole-rat(101719069) RUN and FYVE domain containing 1
domestic guinea pig(100731145) RUN and FYVE domain containing 1
Zebrafish(100294511) RUN and FYVE domain containing 1
Horse(100067514) RUN and FYVE domain containing 1
domestic cat(101086369) RUN and FYVE domain containing 1
dog(481454) RUN and FYVE domain containing 1
chicken(426519) RUN and FYVE domain containing 1
87 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025158 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025158 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025158 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172557 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172557 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172557 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040451 Rosetta Predictions human pricing
NM_001040452 Rosetta Predictions human pricing
NM_025158 Rosetta Predictions human pricing
XM_001071405 Rosetta Predictions rat pricing
XM_340794 Rosetta Predictions rat pricing
NM_172557 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040451 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146642 predicted 964
2 SASI_Hs01_00146643 predicted 1267
3 SASI_Hs01_00146644 predicted 1344
4 SASI_Hs01_00146645 predicted 544
5 SASI_Hs02_00308989 predicted 706
6 SASI_Hs01_00146646 predicted 605
7 SASI_Hs01_00146647 predicted 1683
8 SASI_Hs01_00146648 predicted 802
9 SASI_Hs01_00146650 predicted 1913
10 SASI_Hs02_00308990 predicted 507
11 SASI_Hs01_00146649 predicted 2182
12 SASI_Hs01_00146651 predicted 1175
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040452 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215167 predicted 768
2 SASI_Hs01_00215168 predicted 1071
3 SASI_Hs01_00215169 predicted 1156
4 SASI_Hs01_00215170 predicted 352
5 SASI_Hs02_00308991 predicted 516
6 SASI_Hs01_00215171 predicted 421
7 SASI_Hs01_00215172 predicted 1492
8 SASI_Hs01_00215173 predicted 604
9 SASI_Hs01_00215175 predicted 1724
10 SASI_Hs02_00308992 predicted 311
11 SASI_Hs01_00215174 predicted 1986
12 SASI_Hs01_00215176 predicted 988
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025158 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050530 predicted 980
2 SASI_Hs01_00050531 predicted 1281
3 SASI_Hs01_00050532 predicted 1368
4 SASI_Hs01_00050533 predicted 556
5 SASI_Hs02_00357910 predicted 719
6 SASI_Hs01_00050534 predicted 620
7 SASI_Hs01_00050535 predicted 1698
8 SASI_Hs01_00050536 predicted 809
9 SASI_Hs01_00050538 predicted 1937
10 SASI_Hs02_00357911 predicted 519
11 SASI_Hs01_00050537 predicted 2190
12 SASI_Hs01_00050539 predicted 1185
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071405 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00335020 predicted 998
2 SASI_Rn02_00335021 predicted 1573
3 SASI_Rn02_00335022 predicted 1100
4 SASI_Rn02_00335023 predicted 1939
5 SASI_Rn02_00335024 predicted 696
6 SASI_Rn02_00335025 predicted 1311
7 SASI_Rn02_00335026 predicted 953
8 SASI_Rn02_00335027 predicted 1174
9 SASI_Rn02_00335028 predicted 921
10 SASI_Rn02_00335029 predicted 1036
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_340794 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391889 predicted 1006
2 SASI_Rn02_00391890 predicted 1582
3 SASI_Rn02_00391891 predicted 1096
4 SASI_Rn02_00391892 predicted 1946
5 SASI_Rn02_00391893 predicted 693
6 SASI_Rn02_00391894 predicted 1313
7 SASI_Rn02_00391895 predicted 962
8 SASI_Rn02_00391896 predicted 1171
9 SASI_Rn02_00391897 predicted 917
10 SASI_Rn02_00391898 predicted 1036
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172557 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184252 predicted 719
2 SASI_Mm01_00184253 predicted 1967
3 SASI_Mm01_00184254 predicted 993
4 SASI_Mm02_00344186 predicted 1020
5 SASI_Mm01_00184255 predicted 1165
6 SASI_Mm01_00184256 predicted 1242
7 SASI_Mm01_00184258 predicted 1384
8 SASI_Mm01_00184259 predicted 1499
9 SASI_Mm01_00184260 predicted 912
10 SASI_Mm01_00184261 predicted 1028
11 SASI_Mm01_00184257 predicted 653
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025158
VALIDATED
RUFY1 MISSION shRNA Bacterial Glycerol Stock
RUN and FYVE domain containing 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025158.3-1476s21c1
Sequence:CCGGCCAAGTTATGTCCAGCATGAACTCGAGTTCATGCTGGACATAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025158.3-2360s21c1
Sequence:CCGGGCTCTGGTTCAGATACAACTTCTCGAGAAGTTGTATCTGAACCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_025158.3-1687s21c1
Sequence:CCGGCGCGAATTACAGCACGAGAAACTCGAGTTTCTCGTGCTGTAATTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025158.3-477s21c1
Sequence:CCGGGCTGAAAGTTAAGAAGAGTTTCTCGAGAAACTCTTCTTAACTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073073    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025158.2-2342s1c1
Sequence:CCGGGCTCTGGTTCAGATACAACTTCTCGAGAAGTTGTATCTGAACCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_025158.2-1669s1c1
Sequence:CCGGCGCGAATTACAGCACGAGAAACTCGAGTTTCTCGTGCTGTAATTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025158.2-1458s1c1
Sequence:CCGGCCAAGTTATGTCCAGCATGAACTCGAGTTCATGCTGGACATAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_025158.2-703s1c1
Sequence:CCGGGAGGCTTTAATGATGGAGGAACTCGAGTTCCTCCATCATTAAAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025158.2-459s1c1
Sequence:CCGGGCTGAAAGTTAAGAAGAGTTTCTCGAGAAACTCTTCTTAACTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025158
VALIDATED
RUFY1 MISSION shRNA shRNA Plasmid DNA
RUN and FYVE domain containing 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025158.3-1476s21c1
Sequence:CCGGCCAAGTTATGTCCAGCATGAACTCGAGTTCATGCTGGACATAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025158.3-2360s21c1
Sequence:CCGGGCTCTGGTTCAGATACAACTTCTCGAGAAGTTGTATCTGAACCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_025158.3-1687s21c1
Sequence:CCGGCGCGAATTACAGCACGAGAAACTCGAGTTTCTCGTGCTGTAATTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025158.3-477s21c1
Sequence:CCGGGCTGAAAGTTAAGAAGAGTTTCTCGAGAAACTCTTCTTAACTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073073    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025158.2-2342s1c1
Sequence:CCGGGCTCTGGTTCAGATACAACTTCTCGAGAAGTTGTATCTGAACCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_025158.2-1669s1c1
Sequence:CCGGCGCGAATTACAGCACGAGAAACTCGAGTTTCTCGTGCTGTAATTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025158.2-1458s1c1
Sequence:CCGGCCAAGTTATGTCCAGCATGAACTCGAGTTCATGCTGGACATAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_025158.2-703s1c1
Sequence:CCGGGAGGCTTTAATGATGGAGGAACTCGAGTTCCTCCATCATTAAAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025158.2-459s1c1
Sequence:CCGGGCTGAAAGTTAAGAAGAGTTTCTCGAGAAACTCTTCTTAACTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025158
VALIDATED
RUFY1 MISSION shRNA Lentiviral Transduction Particles
RUN and FYVE domain containing 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025158.3-1476s21c1
Sequence:CCGGCCAAGTTATGTCCAGCATGAACTCGAGTTCATGCTGGACATAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025158.3-2360s21c1
Sequence:CCGGGCTCTGGTTCAGATACAACTTCTCGAGAAGTTGTATCTGAACCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_025158.3-1687s21c1
Sequence:CCGGCGCGAATTACAGCACGAGAAACTCGAGTTTCTCGTGCTGTAATTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025158.3-477s21c1
Sequence:CCGGGCTGAAAGTTAAGAAGAGTTTCTCGAGAAACTCTTCTTAACTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073073    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025158.2-2342s1c1
Sequence:CCGGGCTCTGGTTCAGATACAACTTCTCGAGAAGTTGTATCTGAACCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_025158.2-1669s1c1
Sequence:CCGGCGCGAATTACAGCACGAGAAACTCGAGTTTCTCGTGCTGTAATTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025158.2-1458s1c1
Sequence:CCGGCCAAGTTATGTCCAGCATGAACTCGAGTTCATGCTGGACATAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_025158.2-703s1c1
Sequence:CCGGGAGGCTTTAATGATGGAGGAACTCGAGTTCCTCCATCATTAAAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025158.2-459s1c1
Sequence:CCGGGCTGAAAGTTAAGAAGAGTTTCTCGAGAAACTCTTCTTAACTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172557
VALIDATED
RUFY1 MISSION shRNA Bacterial Glycerol Stock
RUN and FYVE domain containing 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172557.2-729s21c1
Sequence:CCGGCTATGAGCCCGAGGCCTTAATCTCGAGATTAAGGCCTCGGGCTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172557.2-1167s21c1
Sequence:CCGGGGTTGAACTGGAGACTTATAACTCGAGTTATAAGTCTCCAGTTCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_172557.2-1107s1c1
Sequence:CCGGGAACGAAGTAATTCGAGAAAGCTCGAGCTTTCTCGAATTACTTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241685    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172557.2-2380s21c1
Sequence:CCGGCTTCTGTGTCCTCAGTTAAATCTCGAGATTTAACTGAGGACACAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172557.2-2009s21c1
Sequence:CCGGGCCGAAACTGTGGCCACATTTCTCGAGAAATGTGGCCACAGTTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172557.2-1050s21c1
Sequence:CCGGAGCTGCAACAGACCGAATTTGCTCGAGCAAATTCGGTCTGTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202352    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_172557.1-2476s1c1
Sequence:CCGGGCAGCAGTTGCACTAGAGAATCTCGAGATTCTCTAGTGCAACTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172557.1-903s1c1
Sequence:CCGGGCAGAGAGCATGAAAGAATTACTCGAGTAATTCTTTCATGCTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_172557.1-914s1c1
Sequence:CCGGGAAAGAATTACCGATGTCCTTCTCGAGAAGGACATCGGTAATTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172557
VALIDATED
RUFY1 MISSION shRNA shRNA Plasmid DNA
RUN and FYVE domain containing 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172557.2-729s21c1
Sequence:CCGGCTATGAGCCCGAGGCCTTAATCTCGAGATTAAGGCCTCGGGCTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172557.2-1167s21c1
Sequence:CCGGGGTTGAACTGGAGACTTATAACTCGAGTTATAAGTCTCCAGTTCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_172557.2-1107s1c1
Sequence:CCGGGAACGAAGTAATTCGAGAAAGCTCGAGCTTTCTCGAATTACTTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241685    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172557.2-2380s21c1
Sequence:CCGGCTTCTGTGTCCTCAGTTAAATCTCGAGATTTAACTGAGGACACAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172557.2-2009s21c1
Sequence:CCGGGCCGAAACTGTGGCCACATTTCTCGAGAAATGTGGCCACAGTTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172557.2-1050s21c1
Sequence:CCGGAGCTGCAACAGACCGAATTTGCTCGAGCAAATTCGGTCTGTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202352    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_172557.1-2476s1c1
Sequence:CCGGGCAGCAGTTGCACTAGAGAATCTCGAGATTCTCTAGTGCAACTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172557.1-903s1c1
Sequence:CCGGGCAGAGAGCATGAAAGAATTACTCGAGTAATTCTTTCATGCTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_172557.1-914s1c1
Sequence:CCGGGAAAGAATTACCGATGTCCTTCTCGAGAAGGACATCGGTAATTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172557
VALIDATED
RUFY1 MISSION shRNA Lentiviral Transduction Particles
RUN and FYVE domain containing 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172557.2-729s21c1
Sequence:CCGGCTATGAGCCCGAGGCCTTAATCTCGAGATTAAGGCCTCGGGCTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172557.2-1167s21c1
Sequence:CCGGGGTTGAACTGGAGACTTATAACTCGAGTTATAAGTCTCCAGTTCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_172557.2-1107s1c1
Sequence:CCGGGAACGAAGTAATTCGAGAAAGCTCGAGCTTTCTCGAATTACTTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241685    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172557.2-2380s21c1
Sequence:CCGGCTTCTGTGTCCTCAGTTAAATCTCGAGATTTAACTGAGGACACAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172557.2-2009s21c1
Sequence:CCGGGCCGAAACTGTGGCCACATTTCTCGAGAAATGTGGCCACAGTTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172557.2-1050s21c1
Sequence:CCGGAGCTGCAACAGACCGAATTTGCTCGAGCAAATTCGGTCTGTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202352    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_172557.1-2476s1c1
Sequence:CCGGGCAGCAGTTGCACTAGAGAATCTCGAGATTCTCTAGTGCAACTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172557.1-903s1c1
Sequence:CCGGGCAGAGAGCATGAAAGAATTACTCGAGTAATTCTTTCATGCTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_172557.1-914s1c1
Sequence:CCGGGAAAGAATTACCGATGTCCTTCTCGAGAAGGACATCGGTAATTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks