EMAIL THIS PAGE TO A FRIEND

RUNX1

runt-related transcription factor 1

Synonyms: AML1 AML1-EVI-1 AMLCR1 CBFA2 EVI-1 PEBP2aB
Gene ID:
Human(861) Summary: Core binding factor (CBF) is a heterodimeric transcription factor that binds to the core element of many enhancers and promoters. The protein encoded by this gene represents the alpha subunit of CBF and is thought to be involved in the development of normal hematopoiesis. Chromosomal translocations involving this gene are well-documented and have been associated with several types of leukemia. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(12394) runt related transcription factor 1
Rat(50662) runt-related transcription factor 1
domestic guinea pig(100724149) runt-related transcription factor 1
Domestic Rabbit(100358993) runt-related transcription factor 1
naked mole-rat(101705852) runt-related transcription factor 1
cow(529631) runt-related transcription factor 1
sheep(101108280) runt-related transcription factor 1
Zebrafish(58126) runt-related transcription factor 1
domestic cat(101084898) runt-related transcription factor 1
dog(487746) runt-related transcription factor 1
chicken(396152) runt-related transcription factor 1
281 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4503433 Anti-AML1 antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
SAB4503434 Anti-AML1 antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunohistochemistry, western blot pricing
SAB4503435 Anti-AML1, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4503854 Anti-phospho-AML1 (pSer276) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4301498 Anti-phospho-AML1 (pSer276) antibody produced in rabbit affinity isolated antibody human, rat, mouse
western blot pricing
SAB4503855 Anti-phospho-AML1 (pSer303) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4301499 Anti-phospho-AML1 (pSer303) antibody produced in rabbit affinity isolated antibody rat, mouse, human
western blot pricing
SAB4504688 Anti-phospho-AML1 (pSer435) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4301341 Anti-phospho-AML1 (pSer435) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB2102063 Anti-RUNX1 (ab1) antibody produced in rabbit affinity isolated antibody human, horse, mouse, rat, zebrafish, rabbit, canine, bovine
western blot pricing
SAB2102064 Anti-RUNX1 (ab2) antibody produced in rabbit affinity isolated antibody zebrafish, rat, horse, rabbit, human, guinea pig, canine, bovine, mouse
western blot pricing
R0406 Anti-RUNX1 (N-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution rat (predicted), mouse, human
immunofluorescence, western blot pricing
SAB1412250 ANTI-RUNX1 antibody produced in mouse clone 4E12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412252 ANTI-RUNX1 antibody produced in mouse clone 2F4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412253 ANTI-RUNX1 antibody produced in mouse clone 2D8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412470 ANTI-RUNX1 antibody produced in mouse clone 3A8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412471 ANTI-RUNX1 antibody produced in mouse clone 3A1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412488 ANTI-RUNX1 antibody produced in mouse clone 3F5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
R9528 Anti-RUNX1 antibody produced in rabbit affinity isolated antibody, ammonium sulfate suspension human, rodent
immunohistochemistry, western blot pricing
HPA004176 Anti-RUNX1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
AV38073 Anti-RUNX1 antibody produced in rabbit affinity isolated antibody rabbit, zebrafish, rat, guinea pig, mouse, horse, canine, bovine, human
western blot pricing
SAB3500417 Anti-RUNX1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, western blot pricing
SAB2104005 Anti-RUNX1 antibody produced in rabbit affinity isolated antibody human, rat, horse, mouse, rabbit, canine, bovine
western blot pricing
SAB2104009 Anti-RUNX1 antibody produced in rabbit affinity isolated antibody human, bovine, canine, rabbit, horse, rat, mouse
western blot pricing
SAB2104011 Anti-RUNX1 antibody produced in rabbit affinity isolated antibody bovine, mouse, horse, rabbit, rat, human, canine
western blot pricing
SAB2104913 Anti-RUNX1 antibody produced in rabbit affinity isolated antibody guinea pig, human, horse, rabbit
western blot pricing
SAB4300709 Anti-RUNX1 antibody produced in rabbit affinity isolated antibody human
western blot pricing
HPA037912 Anti-RUNX1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
WH0000861M6 Monoclonal Anti-RUNX1 antibody produced in mouse clone 2C10, purified immunoglobulin, buffered aqueous solution mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1403639 Monoclonal Anti-RUNX1 antibody produced in mouse clone 4E7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB5300381 Monoclonal Anti-RUNX1 antibody produced in mouse clone 5A1, ascites fluid human
ELISA, immunofluorescence, western blot pricing
SAB5300382 Monoclonal Anti-RUNX1 antibody produced in mouse clone 2B5, ascites fluid human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001754 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001754 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001754 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009821 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009821 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009821 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001890 Rosetta Predictions human pricing
NM_001122607 Rosetta Predictions human pricing
NM_001754 Rosetta Predictions human pricing
NM_017325 Rosetta Predictions rat pricing
NM_001111021 Rosetta Predictions mouse pricing
NM_001111022 Rosetta Predictions mouse pricing
NM_001111023 Rosetta Predictions mouse pricing
NM_009821 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001890 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224353 predicted 2277
2 SASI_Hs02_00303973 predicted 1973
3 SASI_Hs01_00224354 predicted 2330
4 SASI_Hs01_00224355 predicted 2192
5 SASI_Hs02_00303974 predicted 1953
6 SASI_Hs01_00224357 predicted 1987
7 SASI_Hs02_00303975 predicted 2246
8 SASI_Hs01_00224358 predicted 2058
9 SASI_Hs01_00224360 predicted 2279
10 SASI_Hs01_00224361 predicted 1976
11 SASI_Hs01_00224356 predicted 1990
12 SASI_Hs01_00224359 predicted 1969
13 SASI_Hs01_00224362 predicted 2424
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122607 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327066 predicted 2009
2 SASI_Hs02_00327067 predicted 1906
3 SASI_Hs02_00327068 predicted 1980
4 SASI_Hs02_00327069 predicted 1950
5 SASI_Hs02_00327070 predicted 1984
6 SASI_Hs02_00327071 predicted 2003
7 SASI_Hs02_00327072 predicted 1886
8 SASI_Hs02_00327073 predicted 1971
9 SASI_Hs02_00327074 predicted 2050
10 SASI_Hs02_00327075 predicted 1833
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001754 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016147 predicted 974
2 SASI_Hs02_00332476 predicted 669
3 SASI_Hs01_00016148 predicted 1028
4 SASI_Hs01_00016149 predicted 887
5 SASI_Hs02_00332477 predicted 644
6 SASI_Hs01_00016151 predicted 681
7 SASI_Hs02_00332478 predicted 941
8 SASI_Hs01_00016152 predicted 751
9 SASI_Hs01_00016154 predicted 977
10 SASI_Hs01_00016155 predicted 665
11 SASI_Hs01_00016150 predicted 896
12 SASI_Hs01_00016153 predicted 870
13 SASI_Hs01_00016156 predicted 1334
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017325 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092605 predicted 862
2 SASI_Rn02_00261774 predicted 881
3 SASI_Rn01_00092606 predicted 839
4 SASI_Rn01_00092607 predicted 576
5 SASI_Rn01_00092608 predicted 684
6 SASI_Rn01_00092609 predicted 784
7 SASI_Rn01_00092610 predicted 823
8 SASI_Rn01_00092611 predicted 820
9 SASI_Rn01_00092612 predicted 1370
10 SASI_Rn01_00092613 predicted 1018
11 SASI_Rn01_00092614 predicted 1520
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111021 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306068 predicted 1517
2 SASI_Mm02_00306069 predicted 1685
3 SASI_Mm02_00306070 predicted 1700
4 SASI_Mm02_00306071 predicted 1348
5 SASI_Mm02_00306072 predicted 1666
6 SASI_Mm02_00306073 predicted 688
7 SASI_Mm02_00306074 predicted 704
8 SASI_Mm02_00306075 predicted 1754
9 SASI_Mm02_00306076 predicted 922
10 SASI_Mm02_00306077 predicted 618
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111022 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306078 predicted 1325
2 SASI_Mm02_00306079 predicted 1492
3 SASI_Mm02_00306080 predicted 1510
4 SASI_Mm02_00306081 predicted 1152
5 SASI_Mm02_00306082 predicted 1472
6 SASI_Mm02_00306083 predicted 663
7 SASI_Mm02_00306084 predicted 228
8 SASI_Mm02_00306085 predicted 699
9 SASI_Mm02_00306086 predicted 575
10 SASI_Mm02_00306087 predicted 560
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111023 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306088 predicted 2865
2 SASI_Mm02_00306089 predicted 3026
3 SASI_Mm02_00306090 predicted 3043
4 SASI_Mm02_00306091 predicted 2692
5 SASI_Mm02_00306092 predicted 3004
6 SASI_Mm02_00306093 predicted 2007
7 SASI_Mm02_00306094 predicted 2044
8 SASI_Mm02_00306095 predicted 1916
9 SASI_Mm02_00306096 predicted 2261
10 SASI_Mm02_00306097 predicted 1906
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009821 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082017 predicted 2667
2 SASI_Mm01_00082018 predicted 2835
3 SASI_Mm02_00317131 predicted 2850
4 SASI_Mm01_00082023 predicted 2493
5 SASI_Mm01_00082024 predicted 2816
6 SASI_Mm01_00082015 predicted 2014
7 SASI_Mm01_00082016 predicted 2039
8 SASI_Mm01_00082019 predicted 1917
9 SASI_Mm01_00082020 predicted 1901
10 SASI_Mm01_00082021 predicted 2157
11 SASI_Mm01_00082022 predicted 1964
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001754
VALIDATED
RUNX1 MISSION shRNA Bacterial Glycerol Stock
runt-related transcription factor 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001754.2-5088s1c1
Sequence:CCGGGCCTTGAAATACCTGTTTCTTCTCGAGAAGAAACAGGTATTTCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001754.2-1283s1c1
Sequence:CCGGCCTACGATCAGTCCTACCAATCTCGAGATTGGTAGGACTGATCGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001754.2-1051s1c1
Sequence:CCGGCCTCGAAGACATCGGCAGAAACTCGAGTTTCTGCCGATGTCTTCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001754.2-485s1c1
Sequence:CCGGCACAGTGCTTCATGAGAGAATCTCGAGATTCTCTCATGAAGCACTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001754.2-936s1c1
Sequence:CCGGCGGTCGAAGTGGAAGAGGGAACTCGAGTTCCCTCTTCCACTTCGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001754.4-582s21c1
Sequence:CCGGCTGTGATGGCTGGCAATGATGCTCGAGCATCATTGCCAGCCATCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001754.4-949s21c1
Sequence:CCGGGAACCACTCCACTGCCTTTAACTCGAGTTAAAGGCAGTGGAGTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001754.4-646s21c1
Sequence:CCGGGAACCAGGTTGCAAGATTTAACTCGAGTTAAATCTTGCAACCTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001754.4-1030s21c1
Sequence:CCGGCTACGATCAGTCCTACCAATACTCGAGTATTGGTAGGACTGATCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338492    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001754.4-2091s21c1
Sequence:CCGGTCGCCCTGTTTGGCATCTAATCTCGAGATTAGATGCCAAACAGGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001754.4-797s21c1
Sequence:CCGGCCTCGAAGACATCGGCAGAAACTCGAGTTTCTGCCGATGTCTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001754.4-223s21c1
Sequence:CCGGTTCGTACCCACAGTGCTTCATCTCGAGATGAAGCACTGTGGGTACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001754
VALIDATED
RUNX1 MISSION shRNA shRNA Plasmid DNA
runt-related transcription factor 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001754.2-5088s1c1
Sequence:CCGGGCCTTGAAATACCTGTTTCTTCTCGAGAAGAAACAGGTATTTCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001754.2-1283s1c1
Sequence:CCGGCCTACGATCAGTCCTACCAATCTCGAGATTGGTAGGACTGATCGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001754.2-1051s1c1
Sequence:CCGGCCTCGAAGACATCGGCAGAAACTCGAGTTTCTGCCGATGTCTTCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001754.2-485s1c1
Sequence:CCGGCACAGTGCTTCATGAGAGAATCTCGAGATTCTCTCATGAAGCACTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001754.2-936s1c1
Sequence:CCGGCGGTCGAAGTGGAAGAGGGAACTCGAGTTCCCTCTTCCACTTCGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001754.4-582s21c1
Sequence:CCGGCTGTGATGGCTGGCAATGATGCTCGAGCATCATTGCCAGCCATCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001754.4-949s21c1
Sequence:CCGGGAACCACTCCACTGCCTTTAACTCGAGTTAAAGGCAGTGGAGTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001754.4-646s21c1
Sequence:CCGGGAACCAGGTTGCAAGATTTAACTCGAGTTAAATCTTGCAACCTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001754.4-1030s21c1
Sequence:CCGGCTACGATCAGTCCTACCAATACTCGAGTATTGGTAGGACTGATCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338492    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001754.4-2091s21c1
Sequence:CCGGTCGCCCTGTTTGGCATCTAATCTCGAGATTAGATGCCAAACAGGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001754.4-797s21c1
Sequence:CCGGCCTCGAAGACATCGGCAGAAACTCGAGTTTCTGCCGATGTCTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001754.4-223s21c1
Sequence:CCGGTTCGTACCCACAGTGCTTCATCTCGAGATGAAGCACTGTGGGTACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001754
VALIDATED
RUNX1 MISSION shRNA Lentiviral Transduction Particles
runt-related transcription factor 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001754.2-5088s1c1
Sequence:CCGGGCCTTGAAATACCTGTTTCTTCTCGAGAAGAAACAGGTATTTCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001754.2-1283s1c1
Sequence:CCGGCCTACGATCAGTCCTACCAATCTCGAGATTGGTAGGACTGATCGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001754.2-1051s1c1
Sequence:CCGGCCTCGAAGACATCGGCAGAAACTCGAGTTTCTGCCGATGTCTTCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001754.2-485s1c1
Sequence:CCGGCACAGTGCTTCATGAGAGAATCTCGAGATTCTCTCATGAAGCACTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001754.2-936s1c1
Sequence:CCGGCGGTCGAAGTGGAAGAGGGAACTCGAGTTCCCTCTTCCACTTCGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001754.4-582s21c1
Sequence:CCGGCTGTGATGGCTGGCAATGATGCTCGAGCATCATTGCCAGCCATCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001754.4-949s21c1
Sequence:CCGGGAACCACTCCACTGCCTTTAACTCGAGTTAAAGGCAGTGGAGTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001754.4-646s21c1
Sequence:CCGGGAACCAGGTTGCAAGATTTAACTCGAGTTAAATCTTGCAACCTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001754.4-1030s21c1
Sequence:CCGGCTACGATCAGTCCTACCAATACTCGAGTATTGGTAGGACTGATCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338492    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001754.4-2091s21c1
Sequence:CCGGTCGCCCTGTTTGGCATCTAATCTCGAGATTAGATGCCAAACAGGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001754.4-797s21c1
Sequence:CCGGCCTCGAAGACATCGGCAGAAACTCGAGTTTCTGCCGATGTCTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001754.4-223s21c1
Sequence:CCGGTTCGTACCCACAGTGCTTCATCTCGAGATGAAGCACTGTGGGTACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009821
VALIDATED
RUNX1 MISSION shRNA Bacterial Glycerol Stock
runt-related transcription factor 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009821.1-2053s1c1
Sequence:CCGGCACCTACCATAGAGCCATCAACTCGAGTTGATGGCTCTATGGTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009821.1-3265s1c1
Sequence:CCGGCCACAAAGAAATCCCTAGATACTCGAGTATCTAGGGATTTCTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009821.1-2497s1c1
Sequence:CCGGGCCCTCCTACCATCTATACTACTCGAGTAGTATAGATGGTAGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009821.1-2027s1c1
Sequence:CCGGGTCTTTACAAATCCGCCACAACTCGAGTTGTGGCGGATTTGTAAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009821.1-1914s1c1
Sequence:CCGGCGGCAGAACTGAGAAATGCTACTCGAGTAGCATTTCTCAGTTCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218119    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009821.2-6025s21c1
Sequence:GTACCGGTATAGCCAAAGCTGATCATTTCTCGAGAAATGATCAGCTTTGGCTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009821.2-2496s21c1
Sequence:CCGGCTCGCCCTCCTACCATCTATACTCGAGTATAGATGGTAGGAGGGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009821.2-2235s21c1
Sequence:CCGGCAGCCTCTCTGCAGAACTTTCCTCGAGGAAAGTTCTGCAGAGAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009821.2-2046s21c1
Sequence:CCGGACAAGTTGCCACCTACCATAGCTCGAGCTATGGTAGGTGGCAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009821.2-2015s21c1
Sequence:CCGGCTCTGACCATCACCGTCTTTACTCGAGTAAAGACGGTGATGGTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009821
VALIDATED
RUNX1 MISSION shRNA shRNA Plasmid DNA
runt-related transcription factor 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009821.1-2053s1c1
Sequence:CCGGCACCTACCATAGAGCCATCAACTCGAGTTGATGGCTCTATGGTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009821.1-3265s1c1
Sequence:CCGGCCACAAAGAAATCCCTAGATACTCGAGTATCTAGGGATTTCTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009821.1-2497s1c1
Sequence:CCGGGCCCTCCTACCATCTATACTACTCGAGTAGTATAGATGGTAGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009821.1-2027s1c1
Sequence:CCGGGTCTTTACAAATCCGCCACAACTCGAGTTGTGGCGGATTTGTAAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009821.1-1914s1c1
Sequence:CCGGCGGCAGAACTGAGAAATGCTACTCGAGTAGCATTTCTCAGTTCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218119    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009821.2-6025s21c1
Sequence:GTACCGGTATAGCCAAAGCTGATCATTTCTCGAGAAATGATCAGCTTTGGCTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009821.2-2496s21c1
Sequence:CCGGCTCGCCCTCCTACCATCTATACTCGAGTATAGATGGTAGGAGGGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009821.2-2235s21c1
Sequence:CCGGCAGCCTCTCTGCAGAACTTTCCTCGAGGAAAGTTCTGCAGAGAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009821.2-2046s21c1
Sequence:CCGGACAAGTTGCCACCTACCATAGCTCGAGCTATGGTAGGTGGCAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009821.2-2015s21c1
Sequence:CCGGCTCTGACCATCACCGTCTTTACTCGAGTAAAGACGGTGATGGTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009821
VALIDATED
RUNX1 MISSION shRNA Lentiviral Transduction Particles
runt-related transcription factor 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009821.1-2053s1c1
Sequence:CCGGCACCTACCATAGAGCCATCAACTCGAGTTGATGGCTCTATGGTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009821.1-3265s1c1
Sequence:CCGGCCACAAAGAAATCCCTAGATACTCGAGTATCTAGGGATTTCTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009821.1-2497s1c1
Sequence:CCGGGCCCTCCTACCATCTATACTACTCGAGTAGTATAGATGGTAGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009821.1-2027s1c1
Sequence:CCGGGTCTTTACAAATCCGCCACAACTCGAGTTGTGGCGGATTTGTAAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009821.1-1914s1c1
Sequence:CCGGCGGCAGAACTGAGAAATGCTACTCGAGTAGCATTTCTCAGTTCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218119    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009821.2-6025s21c1
Sequence:GTACCGGTATAGCCAAAGCTGATCATTTCTCGAGAAATGATCAGCTTTGGCTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009821.2-2496s21c1
Sequence:CCGGCTCGCCCTCCTACCATCTATACTCGAGTATAGATGGTAGGAGGGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009821.2-2235s21c1
Sequence:CCGGCAGCCTCTCTGCAGAACTTTCCTCGAGGAAAGTTCTGCAGAGAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009821.2-2046s21c1
Sequence:CCGGACAAGTTGCCACCTACCATAGCTCGAGCTATGGTAGGTGGCAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009821.2-2015s21c1
Sequence:CCGGCTCTGACCATCACCGTCTTTACTCGAGTAAAGACGGTGATGGTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks