EMAIL THIS PAGE TO A FRIEND

RUSC1-AS1

RUSC1 antisense RNA 1

Synonyms: C1orf104 RP11-21N7.3
UniProtKB ID: Q66K80, Q8NA07
Gene ID:
cow(101906356) RUSC1 antisense RNA 1
33 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2105937 Anti-C1ORF104 antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173639 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173639 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173639 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039517 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039517 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208163 predicted 964
2 SASI_Hs01_00208165 predicted 670
3 SASI_Hs01_00208166 predicted 642
4 SASI_Hs01_00208167 predicted 644
5 SASI_Hs01_00208168 predicted 956
6 SASI_Hs01_00208169 predicted 555
7 SASI_Hs01_00208170 predicted 1056
8 SASI_Hs02_00308553 predicted 614
9 SASI_Hs01_00208171 predicted 728
10 SASI_Hs01_00208172 predicted 613
11 SASI_Hs01_00208164 predicted 973
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173639
RUSC1-AS1 MISSION shRNA Bacterial Glycerol Stock
RUSC1 antisense RNA 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173639.1-273s1c1
Sequence:CCGGCGCAGAGTTTGTCTGGTGAATCTCGAGATTCACCAGACAAACTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163829    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173639.1-1102s1c1
Sequence:CCGGCCTCCCAAATTACTGGGATTACTCGAGTAATCCCAGTAATTTGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163648    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173639.1-757s1c1
Sequence:CCGGGCAGCTAGAAAGAGTGGAATACTCGAGTATTCCACTCTTTCTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159603    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173639.1-823s1c1
Sequence:CCGGGCTGCTACTTTATATCTGTATCTCGAGATACAGATATAAAGTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173639.1-277s1c1
Sequence:CCGGGAGTTTGTCTGGTGAATGCAGCTCGAGCTGCATTCACCAGACAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173639.1-444s1c1
Sequence:CCGGGATCTGGTACTGTTCTGGAGTCTCGAGACTCCAGAACAGTACCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173639
RUSC1-AS1 MISSION shRNA shRNA Plasmid DNA
RUSC1 antisense RNA 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173639.1-273s1c1
Sequence:CCGGCGCAGAGTTTGTCTGGTGAATCTCGAGATTCACCAGACAAACTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163829    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173639.1-1102s1c1
Sequence:CCGGCCTCCCAAATTACTGGGATTACTCGAGTAATCCCAGTAATTTGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163648    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173639.1-757s1c1
Sequence:CCGGGCAGCTAGAAAGAGTGGAATACTCGAGTATTCCACTCTTTCTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159603    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173639.1-823s1c1
Sequence:CCGGGCTGCTACTTTATATCTGTATCTCGAGATACAGATATAAAGTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173639.1-277s1c1
Sequence:CCGGGAGTTTGTCTGGTGAATGCAGCTCGAGCTGCATTCACCAGACAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173639.1-444s1c1
Sequence:CCGGGATCTGGTACTGTTCTGGAGTCTCGAGACTCCAGAACAGTACCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173639
RUSC1-AS1 MISSION shRNA Lentiviral Transduction Particles
RUSC1 antisense RNA 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173639.1-273s1c1
Sequence:CCGGCGCAGAGTTTGTCTGGTGAATCTCGAGATTCACCAGACAAACTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163829    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173639.1-1102s1c1
Sequence:CCGGCCTCCCAAATTACTGGGATTACTCGAGTAATCCCAGTAATTTGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163648    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173639.1-757s1c1
Sequence:CCGGGCAGCTAGAAAGAGTGGAATACTCGAGTATTCCACTCTTTCTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159603    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173639.1-823s1c1
Sequence:CCGGGCTGCTACTTTATATCTGTATCTCGAGATACAGATATAAAGTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173639.1-277s1c1
Sequence:CCGGGAGTTTGTCTGGTGAATGCAGCTCGAGCTGCATTCACCAGACAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173639.1-444s1c1
Sequence:CCGGGATCTGGTACTGTTCTGGAGTCTCGAGACTCCAGAACAGTACCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks