EMAIL THIS PAGE TO A FRIEND

RUSC2

RUN and SH3 domain containing 2

Synonyms: Iporin
Gene ID:
Human(9853) Summary: This gene encodes a RUN and SH3 domain containing protein that interacts with Rab1b and Rab1-binding protein GM130. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jun 2012]
Mouse(100213) RUN and SH3 domain containing 2
Rat(684259) RUN and SH3 domain containing 2
Zebrafish(556081) RUN and SH3 domain containing 2
chicken(431657) RUN and SH3 domain containing 2
domestic cat(101092302) RUN and SH3 domain containing 2
Horse(100055624) RUN and SH3 domain containing 2
dog(481593) RUN and SH3 domain containing 2
cow(507809) RUN and SH3 domain containing 2
sheep(101117219) RUN and SH3 domain containing 2
naked mole-rat(101720324) RUN and SH3 domain containing 2
Domestic Rabbit(100345292) RUN and SH3 domain containing 2
domestic guinea pig(100727501) RUN and SH3 domain containing 2
106 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014806 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014806 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014806 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001037709 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001037709 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001037709 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU100741 MISSION® esiRNA esiRNA human RUSC2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014806 Rosetta Predictions human pricing
NM_001037709 Rosetta Predictions mouse pricing
NM_199057 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014806 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200877 predicted 2954
2 SASI_Hs02_00346325 predicted 3094
3 SASI_Hs01_00200878 predicted 300
4 SASI_Hs02_00346326 predicted 3303
5 SASI_Hs01_00200879 predicted 3291
6 SASI_Hs01_00200881 predicted 3494
7 SASI_Hs01_00200882 predicted 1086
8 SASI_Hs01_00200883 predicted 3221
9 SASI_Hs01_00200885 predicted 550
10 SASI_Hs01_00200886 predicted 3428
11 SASI_Hs01_00200880 predicted 2653
12 SASI_Hs01_00200884 predicted 485
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037709 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289319 predicted 2542
2 SASI_Mm01_00023567 predicted 2997
3 SASI_Mm01_00023569 predicted 3447
4 SASI_Mm01_00023570 predicted 3308
5 SASI_Mm01_00023571 predicted 3379
6 SASI_Mm01_00023572 predicted 947
7 SASI_Mm01_00023573 predicted 2998
8 SASI_Mm01_00023574 predicted 4783
9 SASI_Mm01_00023575 predicted 2736
10 SASI_Mm01_00023576 predicted 3079
11 SASI_Mm01_00023568 predicted 2005
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199057 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351334 predicted 2439
2 SASI_Mm01_00058484 predicted 2893
3 SASI_Mm01_00058486 predicted 3334
4 SASI_Mm01_00058487 predicted 3197
5 SASI_Mm01_00058488 predicted 3275
6 SASI_Mm01_00058489 predicted 843
7 SASI_Mm01_00058490 predicted 2888
8 SASI_Mm01_00058491 predicted 4676
9 SASI_Mm01_00058492 predicted 2622
10 SASI_Mm01_00058493 predicted 2973
11 SASI_Mm01_00058485 predicted 1899
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014806
RUSC2 MISSION shRNA Bacterial Glycerol Stock
RUN and SH3 domain containing 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014806.1-4536s1c1
Sequence:CCGGGAGCTTCCACAAAGGAGACATCTCGAGATGTCTCCTTTGTGGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138250    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014806.1-4996s1c1
Sequence:CCGGCAGAAAGCCATCTACAGGGTTCTCGAGAACCCTGTAGATGGCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014806.1-554s1c1
Sequence:CCGGCCAACTTTCATCTATCCTCTTCTCGAGAAGAGGATAGATGAAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014806.1-1676s1c1
Sequence:CCGGCGCTGGAACGTATGTTGAGTTCTCGAGAACTCAACATACGTTCCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014806.1-2878s1c1
Sequence:CCGGCTAGACCGAAGATCACAAGAACTCGAGTTCTTGTGATCTTCGGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014806.1-252s1c1
Sequence:CCGGGAGCACAAGACCTAATCCCTTCTCGAGAAGGGATTAGGTCTTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014806.1-2908s1c1
Sequence:CCGGGCCCGAAGAAACCCTATCTTTCTCGAGAAAGATAGGGTTTCTTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014806
RUSC2 MISSION shRNA shRNA Plasmid DNA
RUN and SH3 domain containing 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014806.1-4536s1c1
Sequence:CCGGGAGCTTCCACAAAGGAGACATCTCGAGATGTCTCCTTTGTGGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138250    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014806.1-4996s1c1
Sequence:CCGGCAGAAAGCCATCTACAGGGTTCTCGAGAACCCTGTAGATGGCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014806.1-554s1c1
Sequence:CCGGCCAACTTTCATCTATCCTCTTCTCGAGAAGAGGATAGATGAAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014806.1-1676s1c1
Sequence:CCGGCGCTGGAACGTATGTTGAGTTCTCGAGAACTCAACATACGTTCCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014806.1-2878s1c1
Sequence:CCGGCTAGACCGAAGATCACAAGAACTCGAGTTCTTGTGATCTTCGGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014806.1-252s1c1
Sequence:CCGGGAGCACAAGACCTAATCCCTTCTCGAGAAGGGATTAGGTCTTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014806.1-2908s1c1
Sequence:CCGGGCCCGAAGAAACCCTATCTTTCTCGAGAAAGATAGGGTTTCTTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014806
RUSC2 MISSION shRNA Lentiviral Transduction Particles
RUN and SH3 domain containing 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014806.1-4536s1c1
Sequence:CCGGGAGCTTCCACAAAGGAGACATCTCGAGATGTCTCCTTTGTGGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138250    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014806.1-4996s1c1
Sequence:CCGGCAGAAAGCCATCTACAGGGTTCTCGAGAACCCTGTAGATGGCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014806.1-554s1c1
Sequence:CCGGCCAACTTTCATCTATCCTCTTCTCGAGAAGAGGATAGATGAAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014806.1-1676s1c1
Sequence:CCGGCGCTGGAACGTATGTTGAGTTCTCGAGAACTCAACATACGTTCCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014806.1-2878s1c1
Sequence:CCGGCTAGACCGAAGATCACAAGAACTCGAGTTCTTGTGATCTTCGGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014806.1-252s1c1
Sequence:CCGGGAGCACAAGACCTAATCCCTTCTCGAGAAGGGATTAGGTCTTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014806.1-2908s1c1
Sequence:CCGGGCCCGAAGAAACCCTATCTTTCTCGAGAAAGATAGGGTTTCTTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037709
VALIDATED
RUSC2 MISSION shRNA Bacterial Glycerol Stock
RUN and SH3 domain containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037709.1-3473s21c1
Sequence:CCGGGTGATCATCGGCCAACGTAAACTCGAGTTTACGTTGGCCGATGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252578    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001037709.1-5115s21c1
Sequence:CCGGGTCCACTAGGCCGACTGATAACTCGAGTTATCAGTCGGCCTAGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001037709.1-3300s21c1
Sequence:CCGGACACCGCTGTGGACCTTATTGCTCGAGCAATAAGGTCCACAGCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001037709.1-3129s21c1
Sequence:CCGGGCCGGCTGAATGGTCAGATTTCTCGAGAAATCTGACCATTCAGCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001037709.1-3249s21c1
Sequence:CCGGAGGCCATATCCATCGACATACCTCGAGGTATGTCGATGGATATGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037709
VALIDATED
RUSC2 MISSION shRNA shRNA Plasmid DNA
RUN and SH3 domain containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037709.1-3473s21c1
Sequence:CCGGGTGATCATCGGCCAACGTAAACTCGAGTTTACGTTGGCCGATGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252578    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001037709.1-5115s21c1
Sequence:CCGGGTCCACTAGGCCGACTGATAACTCGAGTTATCAGTCGGCCTAGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001037709.1-3300s21c1
Sequence:CCGGACACCGCTGTGGACCTTATTGCTCGAGCAATAAGGTCCACAGCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001037709.1-3129s21c1
Sequence:CCGGGCCGGCTGAATGGTCAGATTTCTCGAGAAATCTGACCATTCAGCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001037709.1-3249s21c1
Sequence:CCGGAGGCCATATCCATCGACATACCTCGAGGTATGTCGATGGATATGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037709
VALIDATED
RUSC2 MISSION shRNA Lentiviral Transduction Particles
RUN and SH3 domain containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037709.1-3473s21c1
Sequence:CCGGGTGATCATCGGCCAACGTAAACTCGAGTTTACGTTGGCCGATGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252578    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001037709.1-5115s21c1
Sequence:CCGGGTCCACTAGGCCGACTGATAACTCGAGTTATCAGTCGGCCTAGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001037709.1-3300s21c1
Sequence:CCGGACACCGCTGTGGACCTTATTGCTCGAGCAATAAGGTCCACAGCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001037709.1-3129s21c1
Sequence:CCGGGCCGGCTGAATGGTCAGATTTCTCGAGAAATCTGACCATTCAGCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001037709.1-3249s21c1
Sequence:CCGGAGGCCATATCCATCGACATACCTCGAGGTATGTCGATGGATATGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks