EMAIL THIS PAGE TO A FRIEND

RUVBL1

RuvB-like AAA ATPase 1

Synonyms: ECP54 INO80H NMP238 PONTIN Pontin52 RVB1 TIH1 TIP49 TIP49A
Gene ID:
Mouse(56505) RuvB-like protein 1
Rat(65137) RuvB-like 1 (E. coli)
Zebrafish(317679) RuvB-like 1 (E. coli)
chicken(416022) RuvB-like 1 (E. coli)
dog(476512) RuvB-like 1 (E. coli)
domestic cat(101089177) RuvB-like 1 (E. coli)
Horse(100049886) RuvB-like 1 (E. coli)
cow(511475) RuvB-like 1 (E. coli)
sheep(101113802) RuvB-like 1 (E. coli)
domestic guinea pig(100720747) RuvB-like 1 (E. coli)
Domestic Rabbit(100338148) RuvB-like 1 (E. coli)
naked mole-rat(101706408) RuvB-like 1 (E. coli)
Gene Class: ATPase
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003707 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003707 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003707 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019685 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019685 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019685 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003707 Rosetta Predictions human pricing
NM_147177 Rosetta Predictions rat pricing
NM_019685 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003707 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131544 predicted 449
2 SASI_Hs01_00131545 predicted 878
3 SASI_Hs01_00131546 predicted 1166
4 SASI_Hs01_00131548 predicted 858
5 SASI_Hs01_00131549 predicted 1253
6 SASI_Hs02_00336123 predicted 570
7 SASI_Hs01_00131550 predicted 372
8 SASI_Hs01_00131551 predicted 535
9 SASI_Hs01_00131552 predicted 1431
10 SASI_Hs01_00131553 predicted 767
11 SASI_Hs01_00131547 predicted 1179
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147177 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268862 predicted 380
2 SASI_Rn02_00268863 predicted 644
3 SASI_Rn02_00268864 predicted 383
4 SASI_Rn02_00268865 predicted 365
5 SASI_Rn02_00268866 predicted 320
6 SASI_Rn02_00268867 predicted 796
7 SASI_Rn02_00268868 predicted 594
8 SASI_Rn02_00268869 predicted 580
9 SASI_Rn02_00268870 predicted 946
10 SASI_Rn02_00268871 predicted 785
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019685 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078925 predicted 665
2 SASI_Mm01_00078926 predicted 395
3 SASI_Mm01_00078927 predicted 1023
4 SASI_Mm01_00078928 predicted 724
5 SASI_Mm01_00078929 predicted 254
6 SASI_Mm01_00078930 predicted 856
7 SASI_Mm01_00078931 predicted 580
8 SASI_Mm01_00078932 predicted 866
9 SASI_Mm01_00078933 predicted 474
10 SASI_Mm01_00078934 predicted 789
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003707
VALIDATED
RUVBL1 MISSION shRNA Bacterial Glycerol Stock
RuvB-like AAA ATPase 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377416    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003707.2-1488s21c1
Sequence:CCGGTTTCAGCAGTAAGAGACTCCCCTCGAGGGGAGTCTCTTACTGCTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003707.2-250s21c1
Sequence:CCGGGTGGCGTCATAGTAGAATTAACTCGAGTTAATTCTACTATGACGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003707.2-1338s21c1
Sequence:CCGGCCGGCCAACTTGCTTGCTAAACTCGAGTTTAGCAAGCAAGTTGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003707.2-1451s21c1
Sequence:CCGGCCAGCAGGATAAGTACATGAACTCGAGTTCATGTACTTATCCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003707.1-704s1c1
Sequence:CCGGGCCACAGAATTCGACCTTGAACTCGAGTTCAAGGTCGAATTCTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003707.1-1310s1c1
Sequence:CCGGCCGGCCAACTTGCTTGCTAAACTCGAGTTTAGCAAGCAAGTTGGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003707.1-222s1c1
Sequence:CCGGGTGGCGTCATAGTAGAATTAACTCGAGTTAATTCTACTATGACGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003707.1-1423s1c1
Sequence:CCGGCCAGCAGGATAAGTACATGAACTCGAGTTCATGTACTTATCCTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003707
VALIDATED
RUVBL1 MISSION shRNA shRNA Plasmid DNA
RuvB-like AAA ATPase 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377416    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003707.2-1488s21c1
Sequence:CCGGTTTCAGCAGTAAGAGACTCCCCTCGAGGGGAGTCTCTTACTGCTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003707.2-250s21c1
Sequence:CCGGGTGGCGTCATAGTAGAATTAACTCGAGTTAATTCTACTATGACGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003707.2-1338s21c1
Sequence:CCGGCCGGCCAACTTGCTTGCTAAACTCGAGTTTAGCAAGCAAGTTGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003707.2-1451s21c1
Sequence:CCGGCCAGCAGGATAAGTACATGAACTCGAGTTCATGTACTTATCCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003707.1-704s1c1
Sequence:CCGGGCCACAGAATTCGACCTTGAACTCGAGTTCAAGGTCGAATTCTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003707.1-1310s1c1
Sequence:CCGGCCGGCCAACTTGCTTGCTAAACTCGAGTTTAGCAAGCAAGTTGGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003707.1-222s1c1
Sequence:CCGGGTGGCGTCATAGTAGAATTAACTCGAGTTAATTCTACTATGACGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003707.1-1423s1c1
Sequence:CCGGCCAGCAGGATAAGTACATGAACTCGAGTTCATGTACTTATCCTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003707
VALIDATED
RUVBL1 MISSION shRNA Lentiviral Transduction Particles
RuvB-like AAA ATPase 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377416    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003707.2-1488s21c1
Sequence:CCGGTTTCAGCAGTAAGAGACTCCCCTCGAGGGGAGTCTCTTACTGCTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003707.2-250s21c1
Sequence:CCGGGTGGCGTCATAGTAGAATTAACTCGAGTTAATTCTACTATGACGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003707.2-1338s21c1
Sequence:CCGGCCGGCCAACTTGCTTGCTAAACTCGAGTTTAGCAAGCAAGTTGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003707.2-1451s21c1
Sequence:CCGGCCAGCAGGATAAGTACATGAACTCGAGTTCATGTACTTATCCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003707.1-704s1c1
Sequence:CCGGGCCACAGAATTCGACCTTGAACTCGAGTTCAAGGTCGAATTCTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003707.1-1310s1c1
Sequence:CCGGCCGGCCAACTTGCTTGCTAAACTCGAGTTTAGCAAGCAAGTTGGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003707.1-222s1c1
Sequence:CCGGGTGGCGTCATAGTAGAATTAACTCGAGTTAATTCTACTATGACGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003707.1-1423s1c1
Sequence:CCGGCCAGCAGGATAAGTACATGAACTCGAGTTCATGTACTTATCCTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019685
VALIDATED
RUVBL1 MISSION shRNA Bacterial Glycerol Stock
RuvB-like AAA ATPase 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000320136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019685.2-864s21c1
Sequence:CCGGGCAAGATATTCTGTCTATGATCTCGAGATCATAGACAGAATATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019685.2-664s21c1
Sequence:CCGGGCTGGAGATGTGATTTACATTCTCGAGAATGTAAATCACATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019685.2-1350s21c1
Sequence:CCGGGCTGGCAAAGATCAATGGCAACTCGAGTTGCCATTGATCTTTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019685.2-733s21c1
Sequence:CCGGGCCACAGAGTTTGACCTTGAACTCGAGTTCAAGGTCAAACTCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019685.1-703s1c1
Sequence:CCGGGCTGGAGATGTGATTTACATTCTCGAGAATGTAAATCACATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019685.1-1389s1c1
Sequence:CCGGGCTGGCAAAGATCAATGGCAACTCGAGTTGCCATTGATCTTTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019685.1-772s1c1
Sequence:CCGGGCCACAGAGTTTGACCTTGAACTCGAGTTCAAGGTCAAACTCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019685.1-903s1c1
Sequence:CCGGGCAAGATATTCTGTCTATGATCTCGAGATCATAGACAGAATATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019685
VALIDATED
RUVBL1 MISSION shRNA shRNA Plasmid DNA
RuvB-like AAA ATPase 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000320136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019685.2-864s21c1
Sequence:CCGGGCAAGATATTCTGTCTATGATCTCGAGATCATAGACAGAATATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019685.2-664s21c1
Sequence:CCGGGCTGGAGATGTGATTTACATTCTCGAGAATGTAAATCACATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019685.2-1350s21c1
Sequence:CCGGGCTGGCAAAGATCAATGGCAACTCGAGTTGCCATTGATCTTTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019685.2-733s21c1
Sequence:CCGGGCCACAGAGTTTGACCTTGAACTCGAGTTCAAGGTCAAACTCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019685.1-703s1c1
Sequence:CCGGGCTGGAGATGTGATTTACATTCTCGAGAATGTAAATCACATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019685.1-1389s1c1
Sequence:CCGGGCTGGCAAAGATCAATGGCAACTCGAGTTGCCATTGATCTTTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019685.1-772s1c1
Sequence:CCGGGCCACAGAGTTTGACCTTGAACTCGAGTTCAAGGTCAAACTCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019685.1-903s1c1
Sequence:CCGGGCAAGATATTCTGTCTATGATCTCGAGATCATAGACAGAATATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019685
VALIDATED
RUVBL1 MISSION shRNA Lentiviral Transduction Particles
RuvB-like AAA ATPase 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000320136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019685.2-864s21c1
Sequence:CCGGGCAAGATATTCTGTCTATGATCTCGAGATCATAGACAGAATATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019685.2-664s21c1
Sequence:CCGGGCTGGAGATGTGATTTACATTCTCGAGAATGTAAATCACATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019685.2-1350s21c1
Sequence:CCGGGCTGGCAAAGATCAATGGCAACTCGAGTTGCCATTGATCTTTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019685.2-733s21c1
Sequence:CCGGGCCACAGAGTTTGACCTTGAACTCGAGTTCAAGGTCAAACTCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019685.1-703s1c1
Sequence:CCGGGCTGGAGATGTGATTTACATTCTCGAGAATGTAAATCACATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019685.1-1389s1c1
Sequence:CCGGGCTGGCAAAGATCAATGGCAACTCGAGTTGCCATTGATCTTTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019685.1-772s1c1
Sequence:CCGGGCCACAGAGTTTGACCTTGAACTCGAGTTCAAGGTCAAACTCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019685.1-903s1c1
Sequence:CCGGGCAAGATATTCTGTCTATGATCTCGAGATCATAGACAGAATATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks