EMAIL THIS PAGE TO A FRIEND

RXRB

retinoid X receptor, beta

Synonyms: DAUDI6 H-2RIIBP NR2B2 RCoR-1
UniProtKB ID: P28702, P28703, Q59G65, Q5JP92, Q5STQ1
Gene ID:
Human(6257) Summary: This gene encodes a member of the retinoid X receptor (RXR) family of nuclear receptors which are involved in mediating the effects of retinoic acid (RA). The encoded protein forms homodimers with the retinoic acid, thyroid hormone, and vitamin D receptors, increasing both DNA binding and transcriptional function on their respective response elements. This gene lies within the major histocompatibility complex (MHC) class II region on chromosome 6. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Mouse(20182) retinoid X receptor beta
Rat(361801) retinoid X receptor beta
naked mole-rat(101723696) retinoid X receptor, beta
domestic guinea pig(100732959) retinoid X receptor, beta
cow(504943) retinoid X receptor, beta
sheep(101110798) retinoid X receptor, beta
domestic cat(101085801) retinoid X receptor, beta
dog(481735) retinoid X receptor, beta
113 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2500900 Anti-RXR β antibody produced in goat affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, western blot pricing
AV39524 Anti-RXRB (AB1) antibody produced in rabbit affinity isolated antibody bovine, human, pig, guinea pig, rabbit, rat, horse, canine, mouse
western blot pricing
AV45637 Anti-RXRB (AB2) antibody produced in rabbit affinity isolated antibody rat, mouse, rabbit, pig, horse, guinea pig, bovine, canine, human
western blot pricing
AV45638 Anti-RXRB (AB3) antibody produced in rabbit affinity isolated antibody human, mouse, pig, rabbit, guinea pig, canine, rat, bovine, horse
western blot pricing
SAB2102072 Anti-RXRB antibody produced in rabbit affinity isolated antibody bovine, human, mouse, rat, pig, guinea pig, canine
western blot pricing
HPA063653 Anti-RXRB antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
R2777 Monoclonal Anti-Retinoid X Receptor β antibody produced in mouse ~1 mg/mL, clone 147, purified immunoglobulin, buffered aqueous solution mouse
western blot pricing
SAB1404342 Monoclonal Anti-RXRB antibody produced in mouse clone 2E6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1402348 Monoclonal Anti-RXRB antibody produced in mouse clone 3C8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
T3757 TTNPB human pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
R4643 9-cis-Retinoic acid ≥98% (HPLC) human pricing
R2625 Retinoic acid ≥98% (HPLC), powder human, mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011306 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011306 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011306 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021976 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021976 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021976 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021976 Rosetta Predictions human pricing
NM_206849 Rosetta Predictions rat pricing
XM_574720 Rosetta Predictions rat pricing
NM_011306 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021976 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069442 predicted 1898
2 SASI_Hs01_00069443 predicted 2184
3 SASI_Hs01_00069444 predicted 1269
4 SASI_Hs01_00069445 predicted 1456
5 SASI_Hs01_00069447 predicted 1915
6 SASI_Hs01_00069448 predicted 1663
7 SASI_Hs01_00069449 predicted 1972
8 SASI_Hs02_00355330 predicted 1313
9 SASI_Hs01_00069451 predicted 1500
10 SASI_Hs02_00355331 predicted 1433
11 SASI_Hs01_00069446 predicted 1905
12 SASI_Hs01_00069450 predicted 1568
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206849 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042084 predicted 709
2 SASI_Rn01_00042085 predicted 1234
3 SASI_Rn01_00042086 predicted 715
4 SASI_Rn01_00042087 predicted 667
5 SASI_Rn01_00042088 predicted 1756
6 SASI_Rn01_00042089 predicted 2021
7 SASI_Rn01_00042090 predicted 1730
8 SASI_Rn01_00042091 predicted 1215
9 SASI_Rn01_00042092 predicted 769
10 SASI_Rn01_00042093 predicted 1364
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574720 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00163237 predicted 966
2 SASI_Rn01_00163238 predicted 1723
3 SASI_Rn01_00163239 predicted 1483
4 SASI_Rn01_00163240 predicted 1743
5 SASI_Rn01_00163241 predicted 1461
6 SASI_Rn01_00163242 predicted 937
7 SASI_Rn01_00163243 predicted 1095
8 SASI_Rn01_00163244 predicted 966
9 SASI_Rn01_00163245 predicted 935
10 SASI_Rn01_00163246 predicted 1162
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011306 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181511 predicted 1877
2 SASI_Mm02_00320379 predicted 2090
3 SASI_Mm01_00181512 predicted 1391
4 SASI_Mm02_00320380 predicted 1314
5 SASI_Mm02_00320381 predicted 1820
6 SASI_Mm02_00320382 predicted 1096
7 SASI_Mm02_00320383 predicted 1986
8 SASI_Mm02_00320384 predicted 634
9 SASI_Mm02_00320385 predicted 582
10 SASI_Mm02_00320386 predicted 1435
11 SASI_Mm01_00181510 predicted 862
12 SASI_Mm01_00181513 predicted 929
13 SASI_Mm01_00181514 predicted 1862
14 SASI_Mm01_00181515 predicted 1904
15 SASI_Mm01_00181516 predicted 818
16 SASI_Mm01_00181517 predicted 1195
17 SASI_Mm01_00181518 predicted 1156
18 SASI_Mm01_00181519 predicted 1116
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011306
VALIDATED
RXRB MISSION shRNA Bacterial Glycerol Stock
retinoid X receptor, beta
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011306.2-1431s1c1
Sequence:CCGGCGGGCAATCATACTGTTTAATCTCGAGATTAAACAGTATGATTGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011306.2-502s1c1
Sequence:CCGGCCTTCCCAGTCATCAGTTCTTCTCGAGAAGAACTGATGACTGGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011306.2-1315s1c1
Sequence:CCGGTGCACAGAAACTCAGCCCATTCTCGAGAATGGGCTGAGTTTCTGTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011306.2-829s1c1
Sequence:CCGGGTCGTGATAACAAAGACTGTACTCGAGTACAGTCTTTGTTATCACGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011306.2-1099s1c1
Sequence:CCGGGCCCAAATGACCCAGTGACTACTCGAGTAGTCACTGGGTCATTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011306.3-502s21c1
Sequence:CCGGCCTTCCCAGTCATCAGTTCTTCTCGAGAAGAACTGATGACTGGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011306.3-640s21c1
Sequence:CCGGATGTGAAGCCACCGGTCTTAGCTCGAGCTAAGACCGGTGGCTTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011306.3-829s21c1
Sequence:CCGGGTCGTGATAACAAAGACTGTACTCGAGTACAGTCTTTGTTATCACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011306.3-1431s21c1
Sequence:CCGGCGGGCAATCATACTGTTTAATCTCGAGATTAAACAGTATGATTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339805    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011306.3-1867s21c1
Sequence:CCGGAGATCCCTGTGAGGACTATATCTCGAGATATAGTCCTCACAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011306
VALIDATED
RXRB MISSION shRNA shRNA Plasmid DNA
retinoid X receptor, beta
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011306.2-1431s1c1
Sequence:CCGGCGGGCAATCATACTGTTTAATCTCGAGATTAAACAGTATGATTGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011306.2-502s1c1
Sequence:CCGGCCTTCCCAGTCATCAGTTCTTCTCGAGAAGAACTGATGACTGGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011306.2-1315s1c1
Sequence:CCGGTGCACAGAAACTCAGCCCATTCTCGAGAATGGGCTGAGTTTCTGTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011306.2-829s1c1
Sequence:CCGGGTCGTGATAACAAAGACTGTACTCGAGTACAGTCTTTGTTATCACGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011306.2-1099s1c1
Sequence:CCGGGCCCAAATGACCCAGTGACTACTCGAGTAGTCACTGGGTCATTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011306.3-502s21c1
Sequence:CCGGCCTTCCCAGTCATCAGTTCTTCTCGAGAAGAACTGATGACTGGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011306.3-640s21c1
Sequence:CCGGATGTGAAGCCACCGGTCTTAGCTCGAGCTAAGACCGGTGGCTTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011306.3-829s21c1
Sequence:CCGGGTCGTGATAACAAAGACTGTACTCGAGTACAGTCTTTGTTATCACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011306.3-1431s21c1
Sequence:CCGGCGGGCAATCATACTGTTTAATCTCGAGATTAAACAGTATGATTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339805    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011306.3-1867s21c1
Sequence:CCGGAGATCCCTGTGAGGACTATATCTCGAGATATAGTCCTCACAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011306
VALIDATED
RXRB MISSION shRNA Lentiviral Transduction Particles
retinoid X receptor, beta
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011306.2-1431s1c1
Sequence:CCGGCGGGCAATCATACTGTTTAATCTCGAGATTAAACAGTATGATTGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011306.2-502s1c1
Sequence:CCGGCCTTCCCAGTCATCAGTTCTTCTCGAGAAGAACTGATGACTGGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011306.2-1315s1c1
Sequence:CCGGTGCACAGAAACTCAGCCCATTCTCGAGAATGGGCTGAGTTTCTGTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011306.2-829s1c1
Sequence:CCGGGTCGTGATAACAAAGACTGTACTCGAGTACAGTCTTTGTTATCACGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011306.2-1099s1c1
Sequence:CCGGGCCCAAATGACCCAGTGACTACTCGAGTAGTCACTGGGTCATTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011306.3-502s21c1
Sequence:CCGGCCTTCCCAGTCATCAGTTCTTCTCGAGAAGAACTGATGACTGGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011306.3-640s21c1
Sequence:CCGGATGTGAAGCCACCGGTCTTAGCTCGAGCTAAGACCGGTGGCTTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011306.3-829s21c1
Sequence:CCGGGTCGTGATAACAAAGACTGTACTCGAGTACAGTCTTTGTTATCACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011306.3-1431s21c1
Sequence:CCGGCGGGCAATCATACTGTTTAATCTCGAGATTAAACAGTATGATTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339805    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011306.3-1867s21c1
Sequence:CCGGAGATCCCTGTGAGGACTATATCTCGAGATATAGTCCTCACAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021976
VALIDATED
RXRB MISSION shRNA Bacterial Glycerol Stock
retinoid X receptor, beta
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021976.3-874s1c1
Sequence:CCGGCCATCCGCAAAGACCTTACATCTCGAGATGTAAGGTCTTTGCGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021976.3-1338s1c1
Sequence:CCGGCGATCCATTGATGTTCGAGATCTCGAGATCTCGAACATCAATGGATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021976.3-1463s1c1
Sequence:CCGGGCGTGACATGAGGATGGACAACTCGAGTTGTCCATCCTCATGTCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021976.3-880s1c1
Sequence:CCGGGCAAAGACCTTACATACTCTTCTCGAGAAGAGTATGTAAGGTCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021976.3-2018s21c1
Sequence:CCGGTGTCGGGTTCTCCCATGATTTCTCGAGAAATCATGGGAGAACCCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021976.3-1503s21c1
Sequence:CCGGAGGGCAATCATTCTGTTTAATCTCGAGATTAAACAGAATGATTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021976.3-712s21c1
Sequence:CCGGATGTGAAGCCACCAGTCTTAGCTCGAGCTAAGACTGGTGGCTTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021976.3-1272s21c1
Sequence:CCGGCTGGATGATCAGGTCATATTGCTCGAGCAATATGACCTGATCATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021976.3-876s21c1
Sequence:CCGGATCCGCAAAGACCTTACATACCTCGAGGTATGTAAGGTCTTTGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021976
VALIDATED
RXRB MISSION shRNA shRNA Plasmid DNA
retinoid X receptor, beta
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021976.3-874s1c1
Sequence:CCGGCCATCCGCAAAGACCTTACATCTCGAGATGTAAGGTCTTTGCGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021976.3-1338s1c1
Sequence:CCGGCGATCCATTGATGTTCGAGATCTCGAGATCTCGAACATCAATGGATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021976.3-1463s1c1
Sequence:CCGGGCGTGACATGAGGATGGACAACTCGAGTTGTCCATCCTCATGTCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021976.3-880s1c1
Sequence:CCGGGCAAAGACCTTACATACTCTTCTCGAGAAGAGTATGTAAGGTCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021976.3-2018s21c1
Sequence:CCGGTGTCGGGTTCTCCCATGATTTCTCGAGAAATCATGGGAGAACCCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021976.3-1503s21c1
Sequence:CCGGAGGGCAATCATTCTGTTTAATCTCGAGATTAAACAGAATGATTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021976.3-712s21c1
Sequence:CCGGATGTGAAGCCACCAGTCTTAGCTCGAGCTAAGACTGGTGGCTTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021976.3-1272s21c1
Sequence:CCGGCTGGATGATCAGGTCATATTGCTCGAGCAATATGACCTGATCATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021976.3-876s21c1
Sequence:CCGGATCCGCAAAGACCTTACATACCTCGAGGTATGTAAGGTCTTTGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021976
VALIDATED
RXRB MISSION shRNA Lentiviral Transduction Particles
retinoid X receptor, beta
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021976.3-874s1c1
Sequence:CCGGCCATCCGCAAAGACCTTACATCTCGAGATGTAAGGTCTTTGCGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021976.3-1338s1c1
Sequence:CCGGCGATCCATTGATGTTCGAGATCTCGAGATCTCGAACATCAATGGATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021976.3-1463s1c1
Sequence:CCGGGCGTGACATGAGGATGGACAACTCGAGTTGTCCATCCTCATGTCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021976.3-880s1c1
Sequence:CCGGGCAAAGACCTTACATACTCTTCTCGAGAAGAGTATGTAAGGTCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021976.3-2018s21c1
Sequence:CCGGTGTCGGGTTCTCCCATGATTTCTCGAGAAATCATGGGAGAACCCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021976.3-1503s21c1
Sequence:CCGGAGGGCAATCATTCTGTTTAATCTCGAGATTAAACAGAATGATTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021976.3-712s21c1
Sequence:CCGGATGTGAAGCCACCAGTCTTAGCTCGAGCTAAGACTGGTGGCTTCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021976.3-1272s21c1
Sequence:CCGGCTGGATGATCAGGTCATATTGCTCGAGCAATATGACCTGATCATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021976.3-876s21c1
Sequence:CCGGATCCGCAAAGACCTTACATACCTCGAGGTATGTAAGGTCTTTGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks