EMAIL THIS PAGE TO A FRIEND

S100A5

S100 calcium binding protein A5

Synonyms: S100D
UniProtKB ID: P33763, Q5RHS3
Gene ID:
Human(6276) Summary: The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein has a Ca2+ affinity 20- to 100-fold higher than the other S100 proteins studied under identical conditions. This protein also binds Zn2+ and Cu2+, and Cu2+ strongly which impairs the binding of Ca2+. This protein is expressed in very restricted regions of the adult brain. [provided by RefSeq, Jul 2008]
Mouse(20199) S100 calcium binding protein A5
Rat(295211) S100 calcium binding protein A5
cow(509251) S100 calcium binding protein A5
sheep(101104541) S100 calcium binding protein A5
domestic guinea pig(100723669) S100 calcium binding protein A5
naked mole-rat(101720898) S100 calcium binding protein A5
domestic cat(101083396) S100 calcium binding protein A5
dog(480142) S100 calcium binding protein A5
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002962 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002962 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002962 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011312 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011312 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011312 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU059541 MISSION® esiRNA esiRNA targeting mouse S100a5 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002962 Rosetta Predictions human pricing
NM_001106438 Rosetta Predictions rat pricing
NM_011312 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002962 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070502 predicted 426
2 SASI_Hs01_00070503 predicted 468
3 SASI_Hs01_00070505 predicted 304
4 SASI_Hs01_00070507 predicted 427
5 SASI_Hs01_00070508 predicted 274
6 SASI_Hs01_00070509 predicted 362
7 SASI_Hs01_00070510 predicted 426
8 SASI_Hs01_00070511 predicted 379
9 SASI_Hs02_00334819 predicted 378
10 SASI_Hs02_00334820 predicted 288
11 SASI_Hs01_00070504 predicted 375
12 SASI_Hs01_00070506 predicted 314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106438 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218958 predicted 221
2 SASI_Rn02_00218959 predicted 216
3 SASI_Rn02_00218960 predicted 217
4 SASI_Rn02_00218961 predicted 215
5 SASI_Rn02_00218962 predicted 400
6 SASI_Rn02_00218963 predicted 224
7 SASI_Rn02_00218964 predicted 64
8 SASI_Rn02_00218965 predicted 178
9 SASI_Rn02_00218966 predicted 52
10 SASI_Rn02_00218967 predicted 348
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011312 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155013 predicted 64
2 SASI_Mm01_00155014 predicted 174
3 SASI_Mm01_00155015 predicted 45
4 SASI_Mm01_00155016 predicted 276
5 SASI_Mm01_00155017 predicted 302
6 SASI_Mm01_00155018 predicted 389
7 SASI_Mm01_00155019 predicted 117
8 SASI_Mm01_00155020 predicted 243
9 SASI_Mm01_00155021 predicted 171
10 SASI_Mm01_00155022 predicted 21
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002962
S100A5 MISSION shRNA Bacterial Glycerol Stock
S100 calcium binding protein A5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002962.1-276s21c1
Sequence:CCGGCACTGTGATGGAGACTCCTCTCTCGAGAGAGGAGTCTCCATCACAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002962.1-300s21c1
Sequence:CCGGGAAGGCCCTGACCACTATGGTCTCGAGACCATAGTGGTCAGGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002962.1-369s21c1
Sequence:CCGGGAGTAGGAAGGAACTCAAGGACTCGAGTCCTTGAGTTCCTTCCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002962.1-526s1c1
Sequence:CCGGGCCTACAACGACTTCTTTCTACTCGAGTAGAAAGAAGTCGTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002962.1-534s1c1
Sequence:CCGGCGACTTCTTTCTAGAGGACAACTCGAGTTGTCCTCTAGAAAGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002962.1-353s1c1
Sequence:CCGGGTAGCAAACTGACCCTGAGTACTCGAGTACTCAGGGTCAGTTTGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002962.1-431s1c1
Sequence:CCGGGCAGCATCGATGACTTGATGACTCGAGTCATCAAGTCATCGATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002962.1-319s1c1
Sequence:CCGGGTGACCACGTTTCACAAATATCTCGAGATATTTGTGAAACGTGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002962
S100A5 MISSION shRNA shRNA Plasmid DNA
S100 calcium binding protein A5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002962.1-276s21c1
Sequence:CCGGCACTGTGATGGAGACTCCTCTCTCGAGAGAGGAGTCTCCATCACAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002962.1-300s21c1
Sequence:CCGGGAAGGCCCTGACCACTATGGTCTCGAGACCATAGTGGTCAGGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002962.1-369s21c1
Sequence:CCGGGAGTAGGAAGGAACTCAAGGACTCGAGTCCTTGAGTTCCTTCCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002962.1-526s1c1
Sequence:CCGGGCCTACAACGACTTCTTTCTACTCGAGTAGAAAGAAGTCGTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002962.1-534s1c1
Sequence:CCGGCGACTTCTTTCTAGAGGACAACTCGAGTTGTCCTCTAGAAAGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002962.1-353s1c1
Sequence:CCGGGTAGCAAACTGACCCTGAGTACTCGAGTACTCAGGGTCAGTTTGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002962.1-431s1c1
Sequence:CCGGGCAGCATCGATGACTTGATGACTCGAGTCATCAAGTCATCGATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002962.1-319s1c1
Sequence:CCGGGTGACCACGTTTCACAAATATCTCGAGATATTTGTGAAACGTGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002962
S100A5 MISSION shRNA Lentiviral Transduction Particles
S100 calcium binding protein A5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002962.1-276s21c1
Sequence:CCGGCACTGTGATGGAGACTCCTCTCTCGAGAGAGGAGTCTCCATCACAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002962.1-300s21c1
Sequence:CCGGGAAGGCCCTGACCACTATGGTCTCGAGACCATAGTGGTCAGGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002962.1-369s21c1
Sequence:CCGGGAGTAGGAAGGAACTCAAGGACTCGAGTCCTTGAGTTCCTTCCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002962.1-526s1c1
Sequence:CCGGGCCTACAACGACTTCTTTCTACTCGAGTAGAAAGAAGTCGTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002962.1-534s1c1
Sequence:CCGGCGACTTCTTTCTAGAGGACAACTCGAGTTGTCCTCTAGAAAGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002962.1-353s1c1
Sequence:CCGGGTAGCAAACTGACCCTGAGTACTCGAGTACTCAGGGTCAGTTTGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002962.1-431s1c1
Sequence:CCGGGCAGCATCGATGACTTGATGACTCGAGTCATCAAGTCATCGATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002962.1-319s1c1
Sequence:CCGGGTGACCACGTTTCACAAATATCTCGAGATATTTGTGAAACGTGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011312
S100A5 MISSION shRNA Bacterial Glycerol Stock
S100 calcium binding protein A5
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011312.2-80s21c1
Sequence:CCGGATTCAGGGAGAGAGGGTAGCACTCGAGTGCTACCCTCTCTCCCTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011312.2-112s21c1
Sequence:CCGGAGTAGGAAAGAACTGAAGGAGCTCGAGCTCCTTCAGTTCTTTCCTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011312.2-101s21c1
Sequence:CCGGAGCTGACCCTGAGTAGGAAAGCTCGAGCTTTCCTACTCAGGGTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011312.1-271s1c1
Sequence:CCGGGCCTACAATGACTTCTTCCTACTCGAGTAGGAAGAAGTCATTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011312.1-61s1c1
Sequence:CCGGGTCACCACTTTCCATAAATATCTCGAGATATTTATGGAAAGTGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011312.1-168s1c1
Sequence:CCGGGAAGGAGAGCAGCATTGATAACTCGAGTTATCAATGCTGCTCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011312.1-219s1c1
Sequence:CCGGCCAGGAGATTGACTTCAAGGACTCGAGTCCTTGAAGTCAATCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011312.1-177s1c1
Sequence:CCGGCAGCATTGATAACTTGATGAACTCGAGTTCATCAAGTTATCAATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011312
S100A5 MISSION shRNA shRNA Plasmid DNA
S100 calcium binding protein A5
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011312.2-80s21c1
Sequence:CCGGATTCAGGGAGAGAGGGTAGCACTCGAGTGCTACCCTCTCTCCCTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011312.2-112s21c1
Sequence:CCGGAGTAGGAAAGAACTGAAGGAGCTCGAGCTCCTTCAGTTCTTTCCTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011312.2-101s21c1
Sequence:CCGGAGCTGACCCTGAGTAGGAAAGCTCGAGCTTTCCTACTCAGGGTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011312.1-271s1c1
Sequence:CCGGGCCTACAATGACTTCTTCCTACTCGAGTAGGAAGAAGTCATTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011312.1-61s1c1
Sequence:CCGGGTCACCACTTTCCATAAATATCTCGAGATATTTATGGAAAGTGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011312.1-168s1c1
Sequence:CCGGGAAGGAGAGCAGCATTGATAACTCGAGTTATCAATGCTGCTCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011312.1-219s1c1
Sequence:CCGGCCAGGAGATTGACTTCAAGGACTCGAGTCCTTGAAGTCAATCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011312.1-177s1c1
Sequence:CCGGCAGCATTGATAACTTGATGAACTCGAGTTCATCAAGTTATCAATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011312
S100A5 MISSION shRNA Lentiviral Transduction Particles
S100 calcium binding protein A5
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011312.2-80s21c1
Sequence:CCGGATTCAGGGAGAGAGGGTAGCACTCGAGTGCTACCCTCTCTCCCTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011312.2-112s21c1
Sequence:CCGGAGTAGGAAAGAACTGAAGGAGCTCGAGCTCCTTCAGTTCTTTCCTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011312.2-101s21c1
Sequence:CCGGAGCTGACCCTGAGTAGGAAAGCTCGAGCTTTCCTACTCAGGGTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011312.1-271s1c1
Sequence:CCGGGCCTACAATGACTTCTTCCTACTCGAGTAGGAAGAAGTCATTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011312.1-61s1c1
Sequence:CCGGGTCACCACTTTCCATAAATATCTCGAGATATTTATGGAAAGTGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011312.1-168s1c1
Sequence:CCGGGAAGGAGAGCAGCATTGATAACTCGAGTTATCAATGCTGCTCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011312.1-219s1c1
Sequence:CCGGCCAGGAGATTGACTTCAAGGACTCGAGTCCTTGAAGTCAATCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011312.1-177s1c1
Sequence:CCGGCAGCATTGATAACTTGATGAACTCGAGTTCATCAAGTTATCAATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks