EMAIL THIS PAGE TO A FRIEND

S100A9

S100 calcium binding protein A9

Synonyms: 60B8AG CAGB CFAG CGLB L1AG LIAG MAC387 MIF MRP14 NIF P14
UniProtKB ID: P06702, D3DV36, Q6FGA1, Q9NYM0, Q9UCJ1
Gene ID:
Human(6280) Summary: The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein may function in the inhibition of casein kinase and altered expression of this protein is associated with the disease cystic fibrosis. [provided by RefSeq, Jul 2008]
Mouse(20202) S100 calcium binding protein A9 (calgranulin B)
Rat(94195) S100 calcium binding protein A9
cow(532569) S100 calcium binding protein A9
naked mole-rat(101719500) S100 calcium binding protein A9
Domestic Rabbit(100008704) S100 calcium binding protein A9
domestic guinea pig(100735238) S100 calcium binding protein A9
chicken(426356) S100 calcium binding protein A9
Horse(100294530) S100 calcium binding protein A9
domestic cat(101084419) S100 calcium binding protein A9
dog(490463) S100 calcium binding protein A9
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002965 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002965 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002965 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009114 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009114 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009114 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU034191 MISSION® esiRNA esiRNA human S100A9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002965 Rosetta Predictions human pricing
NM_053587 Rosetta Predictions rat pricing
NM_009114 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002965 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124556 predicted 303
2 SASI_Hs01_00124557 predicted 256
3 SASI_Hs01_00124558 predicted 255
4 SASI_Hs01_00124559 predicted 229
5 SASI_Hs01_00124560 predicted 306
6 SASI_Hs01_00124562 predicted 277
7 SASI_Hs01_00124563 predicted 246
8 SASI_Hs01_00124564 predicted 296
9 SASI_Hs01_00124565 predicted 296
10 SASI_Hs02_00334825 predicted 329
11 SASI_Hs01_00124561 predicted 340
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053587 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093164 predicted 219
2 SASI_Rn01_00093165 predicted 244
3 SASI_Rn01_00093166 predicted 271
4 SASI_Rn01_00093167 predicted 253
5 SASI_Rn01_00093168 predicted 245
6 SASI_Rn01_00093169 predicted 225
7 SASI_Rn01_00093170 predicted 234
8 SASI_Rn01_00093171 predicted 265
9 SASI_Rn01_00093172 predicted 233
10 SASI_Rn02_00266258 predicted 223
11 SASI_Rn01_00093163 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009114 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028224 predicted 239
2 SASI_Mm01_00028225 predicted 246
3 SASI_Mm01_00028226 predicted 242
4 SASI_Mm01_00028227 predicted 255
5 SASI_Mm01_00028229 predicted 200
6 SASI_Mm01_00028230 predicted 215
7 SASI_Mm01_00028231 predicted 204
8 SASI_Mm01_00028232 predicted 257
9 SASI_Mm01_00028233 predicted 195
10 SASI_Mm02_00315376 predicted 259
11 SASI_Mm01_00028228 predicted 205
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002965
S100A9 MISSION shRNA Bacterial Glycerol Stock
S100 calcium binding protein A9
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002965.2-240s1c1
Sequence:CCGGCCTGGACACAAATGCAGACAACTCGAGTTGTCTGCATTTGTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002965.2-90s1c1
Sequence:CCGGCATCAACACCTTCCACCAATACTCGAGTATTGGTGGAAGGTGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002965.2-264s1c1
Sequence:CCGGGCTGAGCTTCGAGGAGTTCATCTCGAGATGAACTCCTCGAAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002965.2-273s1c1
Sequence:CCGGCGAGGAGTTCATCATGCTGATCTCGAGATCAGCATGATGAACTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002965.2-81s1c1
Sequence:CCGGAGAGACCATCATCAACACCTTCTCGAGAAGGTGTTGATGATGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002965.3-71s21c1
Sequence:CCGGCGCAACATAGAGACCATCATCCTCGAGGATGATGGTCTCTATGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002965.3-215s21c1
Sequence:CCGGGTCATAGAACACATCATGGAGCTCGAGCTCCATGATGTGTTCTATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002965.3-151s21c1
Sequence:CCGGATTCAAAGAGCTGGTGCGAAACTCGAGTTTCGCACCAGCTCTTTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002965.3-102s21c1
Sequence:CCGGACCAATACTCTGTGAAGCTGGCTCGAGCCAGCTTCACAGAGTATTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002965
S100A9 MISSION shRNA shRNA Plasmid DNA
S100 calcium binding protein A9
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002965.2-240s1c1
Sequence:CCGGCCTGGACACAAATGCAGACAACTCGAGTTGTCTGCATTTGTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002965.2-90s1c1
Sequence:CCGGCATCAACACCTTCCACCAATACTCGAGTATTGGTGGAAGGTGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002965.2-264s1c1
Sequence:CCGGGCTGAGCTTCGAGGAGTTCATCTCGAGATGAACTCCTCGAAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002965.2-273s1c1
Sequence:CCGGCGAGGAGTTCATCATGCTGATCTCGAGATCAGCATGATGAACTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002965.2-81s1c1
Sequence:CCGGAGAGACCATCATCAACACCTTCTCGAGAAGGTGTTGATGATGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002965.3-71s21c1
Sequence:CCGGCGCAACATAGAGACCATCATCCTCGAGGATGATGGTCTCTATGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002965.3-215s21c1
Sequence:CCGGGTCATAGAACACATCATGGAGCTCGAGCTCCATGATGTGTTCTATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002965.3-151s21c1
Sequence:CCGGATTCAAAGAGCTGGTGCGAAACTCGAGTTTCGCACCAGCTCTTTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002965.3-102s21c1
Sequence:CCGGACCAATACTCTGTGAAGCTGGCTCGAGCCAGCTTCACAGAGTATTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002965
S100A9 MISSION shRNA Lentiviral Transduction Particles
S100 calcium binding protein A9
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002965.2-240s1c1
Sequence:CCGGCCTGGACACAAATGCAGACAACTCGAGTTGTCTGCATTTGTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002965.2-90s1c1
Sequence:CCGGCATCAACACCTTCCACCAATACTCGAGTATTGGTGGAAGGTGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002965.2-264s1c1
Sequence:CCGGGCTGAGCTTCGAGGAGTTCATCTCGAGATGAACTCCTCGAAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002965.2-273s1c1
Sequence:CCGGCGAGGAGTTCATCATGCTGATCTCGAGATCAGCATGATGAACTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002965.2-81s1c1
Sequence:CCGGAGAGACCATCATCAACACCTTCTCGAGAAGGTGTTGATGATGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002965.3-71s21c1
Sequence:CCGGCGCAACATAGAGACCATCATCCTCGAGGATGATGGTCTCTATGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002965.3-215s21c1
Sequence:CCGGGTCATAGAACACATCATGGAGCTCGAGCTCCATGATGTGTTCTATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002965.3-151s21c1
Sequence:CCGGATTCAAAGAGCTGGTGCGAAACTCGAGTTTCGCACCAGCTCTTTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002965.3-102s21c1
Sequence:CCGGACCAATACTCTGTGAAGCTGGCTCGAGCCAGCTTCACAGAGTATTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009114
S100A9 MISSION shRNA Bacterial Glycerol Stock
S100 calcium binding protein A9
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009114.1-204s1c1
Sequence:CCGGAGCCCTCATAAATGACATCATCTCGAGATGATGTCATTTATGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009114.1-168s1c1
Sequence:CCGGGTTGGCAACCTTTATGAAGAACTCGAGTTCTTCATAAAGGTTGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009114.1-255s1c1
Sequence:CCGGGCTGAGCTTTGAGGAGTGTATCTCGAGATACACTCCTCAAAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009114.1-90s1c1
Sequence:CCGGCTTCCATCAATACTCTAGGAACTCGAGTTCCTAGAGTATTGATGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009114.1-280s1c1
Sequence:CCGGCTGATGGCAAAGTTGATCTTTCTCGAGAAAGATCAACTTTGCCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009114.2-291s21c1
Sequence:CCGGGTTGATCTTTGCCTGTCATGACTCGAGTCATGACAGGCAAAGATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009114.2-311s21c1
Sequence:CCGGAGAAGCTGCATGAGAACAACCCTCGAGGGTTGTTCTCATGCAGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009114
S100A9 MISSION shRNA shRNA Plasmid DNA
S100 calcium binding protein A9
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009114.1-204s1c1
Sequence:CCGGAGCCCTCATAAATGACATCATCTCGAGATGATGTCATTTATGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009114.1-168s1c1
Sequence:CCGGGTTGGCAACCTTTATGAAGAACTCGAGTTCTTCATAAAGGTTGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009114.1-255s1c1
Sequence:CCGGGCTGAGCTTTGAGGAGTGTATCTCGAGATACACTCCTCAAAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009114.1-90s1c1
Sequence:CCGGCTTCCATCAATACTCTAGGAACTCGAGTTCCTAGAGTATTGATGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009114.1-280s1c1
Sequence:CCGGCTGATGGCAAAGTTGATCTTTCTCGAGAAAGATCAACTTTGCCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009114.2-291s21c1
Sequence:CCGGGTTGATCTTTGCCTGTCATGACTCGAGTCATGACAGGCAAAGATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009114.2-311s21c1
Sequence:CCGGAGAAGCTGCATGAGAACAACCCTCGAGGGTTGTTCTCATGCAGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009114
S100A9 MISSION shRNA Lentiviral Transduction Particles
S100 calcium binding protein A9
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009114.1-204s1c1
Sequence:CCGGAGCCCTCATAAATGACATCATCTCGAGATGATGTCATTTATGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009114.1-168s1c1
Sequence:CCGGGTTGGCAACCTTTATGAAGAACTCGAGTTCTTCATAAAGGTTGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009114.1-255s1c1
Sequence:CCGGGCTGAGCTTTGAGGAGTGTATCTCGAGATACACTCCTCAAAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009114.1-90s1c1
Sequence:CCGGCTTCCATCAATACTCTAGGAACTCGAGTTCCTAGAGTATTGATGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009114.1-280s1c1
Sequence:CCGGCTGATGGCAAAGTTGATCTTTCTCGAGAAAGATCAACTTTGCCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009114.2-291s21c1
Sequence:CCGGGTTGATCTTTGCCTGTCATGACTCGAGTCATGACAGGCAAAGATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009114.2-311s21c1
Sequence:CCGGAGAAGCTGCATGAGAACAACCCTCGAGGGTTGTTCTCATGCAGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks