EMAIL THIS PAGE TO A FRIEND

S100B

S100 calcium binding protein B

Synonyms: NEF S100 S100-B S100beta
UniProtKB ID: P04271, D3DSN6
Gene ID:
Human(6285) Summary: The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21; however, this gene is located at 21q22.3. This protein may function in Neurite extension, proliferation of melanoma cells, stimulation of Ca2+ fluxes, inhibition of PKC-mediated phosphorylation, astrocytosis and axonal proliferation, and inhibition of microtubule assembly. Chromosomal rearrangements and altered expression of this gene have been implicated in several neurological, neoplastic, and other types of diseases, including Alzheimer's disease, Down's syndrome, epilepsy, amyotrophic lateral sclerosis, melanoma, and type I diabetes. [provided by RefSeq, Jul 2008]
Mouse(20203) S100 protein, beta polypeptide, neural
Rat(25742) S100 calcium binding protein B
Zebrafish(436825) S100 calcium binding protein, beta (neural)
chicken(424038) S100 calcium binding protein B
dog(491615) S100 calcium binding protein B
domestic cat(101099488) S100 calcium binding protein B
domestic guinea pig(100726901) S100 calcium binding protein B
Domestic Rabbit(100009495) S100 calcium binding protein B
naked mole-rat(101719562) S100 calcium binding protein B
cow(525716) S100 calcium binding protein B
sheep(101113190) S100 calcium binding protein B
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB5500172 Anti-S100 Beta antibody, Rabbit monoclonal clone SP127, recombinant, expressed in proprietary host, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry pricing
SAB2108392 Anti-S100B antibody produced in rabbit affinity isolated antibody rat, horse, human, rabbit, guinea pig
western blot pricing
HPA015768 Anti-S100B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2106315 Anti-S100B antibody produced in rabbit affinity isolated antibody, lyophilized powder human, rabbit, horse, rat
ELISA, western blot pricing
S2532 Monoclonal Anti-S-100 (β-Subunit) antibody produced in mouse clone SH-B1, ascites fluid sheep, rat, pig, goat, rabbit, feline, human, canine, bovine
dot blot, ELISA, immunohistochemistry, microarray pricing
S2657 Monoclonal Anti-S-100 (β-Subunit) antibody produced in mouse clone SH-B4, ascites fluid human, sheep, rabbit, canine, bovine, pig, goat, feline, rat
ELISA, immunohistochemistry pricing
SAB1402349 Monoclonal Anti-S100B antibody produced in mouse clone 1B2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
AMAB91038 Monoclonal Anti-S100B antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL2720, purified immunoglobulin, buffered aqueous glycerol solution human, rat, mouse
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006272 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006272 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006272 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009115 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009115 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009115 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU007051 MISSION® esiRNA esiRNA targeting human S100B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006272 Rosetta Predictions human pricing
NM_013191 Rosetta Predictions rat pricing
NM_009115 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006272 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140287 predicted 640
2 SASI_Hs01_00140288 predicted 806
3 SASI_Hs01_00140289 predicted 472
4 SASI_Hs01_00140291 predicted 620
5 SASI_Hs01_00140292 predicted 765
6 SASI_Hs01_00140293 predicted 646
7 SASI_Hs01_00140294 predicted 310
8 SASI_Hs02_00341236 predicted 427
9 SASI_Hs01_00140295 predicted 398
10 SASI_Hs01_00140296 predicted 368
11 SASI_Hs01_00140290 predicted 272
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013191 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101564 predicted 853
2 SASI_Rn01_00101565 predicted 763
3 SASI_Rn02_00261042 predicted 678
4 SASI_Rn01_00101567 predicted 178
5 SASI_Rn01_00101568 predicted 239
6 SASI_Rn01_00101569 predicted 330
7 SASI_Rn01_00101570 predicted 149
8 SASI_Rn01_00101571 predicted 132
9 SASI_Rn01_00101572 predicted 217
10 SASI_Rn01_00101573 predicted 369
11 SASI_Rn01_00101566 predicted 777
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009115 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315377 predicted 687
2 SASI_Mm02_00315378 predicted 738
3 SASI_Mm02_00315379 predicted 869
4 SASI_Mm02_00315380 predicted 898
5 SASI_Mm02_00315381 predicted 650
6 SASI_Mm02_00315382 predicted 684
7 SASI_Mm02_00315383 predicted 600
8 SASI_Mm02_00315384 predicted 222
9 SASI_Mm02_00315385 predicted 143
10 SASI_Mm02_00315386 predicted 521
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006272
S100B MISSION shRNA Bacterial Glycerol Stock
S100 calcium binding protein B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006272.2-572s21c1
Sequence:CCGGCATCATTCTTTCTGCTATATTCTCGAGAATATAGCAGAAAGAATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006272.2-647s21c1
Sequence:CCGGAGTCAGGTCTCAGTGATAAAGCTCGAGCTTTATCACTGAGACCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006272.2-203s21c1
Sequence:CCGGCCGAACTGAAGGAGCTCATCACTCGAGTGATGAGCTCCTTCAGTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006272.1-322s1c1
Sequence:CCGGGCCTGCCACGAGTTCTTTGAACTCGAGTTCAAAGAACTCGTGGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006272.1-264s1c1
Sequence:CCGGTGGAGACGGCGAATGTGACTTCTCGAGAAGTCACATTCGCCGTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006272.1-256s1c1
Sequence:CCGGGACAATGATGGAGACGGCGAACTCGAGTTCGCCGTCTCCATCATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006272.1-250s1c1
Sequence:CCGGACACTGGACAATGATGGAGACCTCGAGGTCTCCATCATTGTCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006272
S100B MISSION shRNA shRNA Plasmid DNA
S100 calcium binding protein B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006272.2-572s21c1
Sequence:CCGGCATCATTCTTTCTGCTATATTCTCGAGAATATAGCAGAAAGAATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006272.2-647s21c1
Sequence:CCGGAGTCAGGTCTCAGTGATAAAGCTCGAGCTTTATCACTGAGACCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006272.2-203s21c1
Sequence:CCGGCCGAACTGAAGGAGCTCATCACTCGAGTGATGAGCTCCTTCAGTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006272.1-322s1c1
Sequence:CCGGGCCTGCCACGAGTTCTTTGAACTCGAGTTCAAAGAACTCGTGGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006272.1-264s1c1
Sequence:CCGGTGGAGACGGCGAATGTGACTTCTCGAGAAGTCACATTCGCCGTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006272.1-256s1c1
Sequence:CCGGGACAATGATGGAGACGGCGAACTCGAGTTCGCCGTCTCCATCATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006272.1-250s1c1
Sequence:CCGGACACTGGACAATGATGGAGACCTCGAGGTCTCCATCATTGTCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006272
S100B MISSION shRNA Lentiviral Transduction Particles
S100 calcium binding protein B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006272.2-572s21c1
Sequence:CCGGCATCATTCTTTCTGCTATATTCTCGAGAATATAGCAGAAAGAATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006272.2-647s21c1
Sequence:CCGGAGTCAGGTCTCAGTGATAAAGCTCGAGCTTTATCACTGAGACCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006272.2-203s21c1
Sequence:CCGGCCGAACTGAAGGAGCTCATCACTCGAGTGATGAGCTCCTTCAGTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006272.1-322s1c1
Sequence:CCGGGCCTGCCACGAGTTCTTTGAACTCGAGTTCAAAGAACTCGTGGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006272.1-264s1c1
Sequence:CCGGTGGAGACGGCGAATGTGACTTCTCGAGAAGTCACATTCGCCGTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006272.1-256s1c1
Sequence:CCGGGACAATGATGGAGACGGCGAACTCGAGTTCGCCGTCTCCATCATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006272.1-250s1c1
Sequence:CCGGACACTGGACAATGATGGAGACCTCGAGGTCTCCATCATTGTCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009115
VALIDATED
S100B MISSION shRNA Bacterial Glycerol Stock
S100 calcium binding protein B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009115.2-364s1c1
Sequence:CCGGGCCTGCCATGAGTTCTTTGAACTCGAGTTCAAAGAACTCATGGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009115.2-206s1c1
Sequence:CCGGCAGAACTGAAGGAGCTTATCACTCGAGTGATAAGCTCCTTCAGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009115.2-141s1c1
Sequence:CCGGTGCCCTCATTGATGTCTTCCACTCGAGTGGAAGACATCAATGAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009115.2-190s1c1
Sequence:CCGGCACAAGCTGAAGAAGTCAGAACTCGAGTTCTGACTTCTTCAGCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009115.2-262s1c1
Sequence:CCGGGAGCAGGAAGTGGTGGACAAACTCGAGTTTGTCCACCACTTCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009115
VALIDATED
S100B MISSION shRNA shRNA Plasmid DNA
S100 calcium binding protein B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009115.2-364s1c1
Sequence:CCGGGCCTGCCATGAGTTCTTTGAACTCGAGTTCAAAGAACTCATGGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009115.2-206s1c1
Sequence:CCGGCAGAACTGAAGGAGCTTATCACTCGAGTGATAAGCTCCTTCAGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009115.2-141s1c1
Sequence:CCGGTGCCCTCATTGATGTCTTCCACTCGAGTGGAAGACATCAATGAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009115.2-190s1c1
Sequence:CCGGCACAAGCTGAAGAAGTCAGAACTCGAGTTCTGACTTCTTCAGCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009115.2-262s1c1
Sequence:CCGGGAGCAGGAAGTGGTGGACAAACTCGAGTTTGTCCACCACTTCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009115
VALIDATED
S100B MISSION shRNA Lentiviral Transduction Particles
S100 calcium binding protein B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009115.2-364s1c1
Sequence:CCGGGCCTGCCATGAGTTCTTTGAACTCGAGTTCAAAGAACTCATGGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009115.2-206s1c1
Sequence:CCGGCAGAACTGAAGGAGCTTATCACTCGAGTGATAAGCTCCTTCAGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009115.2-141s1c1
Sequence:CCGGTGCCCTCATTGATGTCTTCCACTCGAGTGGAAGACATCAATGAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009115.2-190s1c1
Sequence:CCGGCACAAGCTGAAGAAGTCAGAACTCGAGTTCTGACTTCTTCAGCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009115.2-262s1c1
Sequence:CCGGGAGCAGGAAGTGGTGGACAAACTCGAGTTTGTCCACCACTTCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks