EMAIL THIS PAGE TO A FRIEND

S100P

S100 calcium binding protein P

Synonyms: MIG9
Species: Human S100P(6286), dog S100P(610295), domestic cat S100P(101091279), domestic guinea pig S100p(100714988), naked mole-rat S100p(101713579)
UniProtKB ID: P25815, Q5J7W2
Gene ID:
Human(6286) Summary: The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21; however, this gene is located at 4p16. This protein, in addition to binding Ca2+, also binds Zn2+ and Mg2+. This protein may play a role in the etiology of prostate cancer. [provided by RefSeq, Jul 2008]
dog(610295) S100 calcium binding protein P
domestic cat(101091279) S100 calcium binding protein P
domestic guinea pig(100714988) S100 calcium binding protein P
naked mole-rat(101713579) S100 calcium binding protein P
19 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005980 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005980 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005980 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005980 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005980 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157321 predicted 215
2 SASI_Hs01_00157322 predicted 241
3 SASI_Hs01_00157323 predicted 234
4 SASI_Hs01_00157324 predicted 238
5 SASI_Hs01_00157326 predicted 264
6 SASI_Hs01_00157327 predicted 232
7 SASI_Hs01_00157328 predicted 267
8 SASI_Hs01_00157329 predicted 266
9 SASI_Hs01_00157330 predicted 246
10 SASI_Hs02_00340666 predicted 270
11 SASI_Hs01_00157325 predicted 244
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005980
S100P MISSION shRNA Bacterial Glycerol Stock
S100 calcium binding protein P
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005980.2-220s21c1
Sequence:CCGGAGGCTTCCTGCAGAGTGGAAACTCGAGTTTCCACTCTGCAGGAAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005980.2-318s21c1
Sequence:CCGGTCGTGTTCGTGGCTGCAATCACTCGAGTGATTGCAGCCACGAACACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005980.2-201s21c1
Sequence:CCGGTGATGGAGAAGGAGCTACCAGCTCGAGCTGGTAGCTCCTTCTCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005980.2-361s21c1
Sequence:CCGGTGAGAAGGCAGGACTCAAATGCTCGAGCATTTGAGTCCTGCCTTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005980.2-304s1c1
Sequence:CCGGCTTCAGTGAGTTCATCGTGTTCTCGAGAACACGATGAACTCACTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005980.2-190s1c1
Sequence:CCGGGCTCAAGGTGCTGATGGAGAACTCGAGTTCTCCATCAGCACCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005980.2-250s1c1
Sequence:CCGGTGCCGTGGATAAATTGCTCAACTCGAGTTGAGCAATTTATCCACGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005980.2-242s1c1
Sequence:CCGGGACAAGGATGCCGTGGATAAACTCGAGTTTATCCACGGCATCCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005980
S100P MISSION shRNA shRNA Plasmid DNA
S100 calcium binding protein P
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005980.2-220s21c1
Sequence:CCGGAGGCTTCCTGCAGAGTGGAAACTCGAGTTTCCACTCTGCAGGAAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005980.2-318s21c1
Sequence:CCGGTCGTGTTCGTGGCTGCAATCACTCGAGTGATTGCAGCCACGAACACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005980.2-201s21c1
Sequence:CCGGTGATGGAGAAGGAGCTACCAGCTCGAGCTGGTAGCTCCTTCTCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005980.2-361s21c1
Sequence:CCGGTGAGAAGGCAGGACTCAAATGCTCGAGCATTTGAGTCCTGCCTTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005980.2-304s1c1
Sequence:CCGGCTTCAGTGAGTTCATCGTGTTCTCGAGAACACGATGAACTCACTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005980.2-190s1c1
Sequence:CCGGGCTCAAGGTGCTGATGGAGAACTCGAGTTCTCCATCAGCACCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005980.2-250s1c1
Sequence:CCGGTGCCGTGGATAAATTGCTCAACTCGAGTTGAGCAATTTATCCACGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005980.2-242s1c1
Sequence:CCGGGACAAGGATGCCGTGGATAAACTCGAGTTTATCCACGGCATCCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005980
S100P MISSION shRNA Lentiviral Transduction Particles
S100 calcium binding protein P
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005980.2-220s21c1
Sequence:CCGGAGGCTTCCTGCAGAGTGGAAACTCGAGTTTCCACTCTGCAGGAAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005980.2-318s21c1
Sequence:CCGGTCGTGTTCGTGGCTGCAATCACTCGAGTGATTGCAGCCACGAACACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005980.2-201s21c1
Sequence:CCGGTGATGGAGAAGGAGCTACCAGCTCGAGCTGGTAGCTCCTTCTCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005980.2-361s21c1
Sequence:CCGGTGAGAAGGCAGGACTCAAATGCTCGAGCATTTGAGTCCTGCCTTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005980.2-304s1c1
Sequence:CCGGCTTCAGTGAGTTCATCGTGTTCTCGAGAACACGATGAACTCACTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005980.2-190s1c1
Sequence:CCGGGCTCAAGGTGCTGATGGAGAACTCGAGTTCTCCATCAGCACCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005980.2-250s1c1
Sequence:CCGGTGCCGTGGATAAATTGCTCAACTCGAGTTGAGCAATTTATCCACGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005980.2-242s1c1
Sequence:CCGGGACAAGGATGCCGTGGATAAACTCGAGTTTATCCACGGCATCCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks