EMAIL THIS PAGE TO A FRIEND

S1PR1

sphingosine-1-phosphate receptor 1

Synonyms: CD363 CHEDG1 D1S3362 ECGF1 EDG-1 EDG1 S1P1
UniProtKB ID: P21453, D3DT66, Q9BYY4, Q9NYN8
Gene ID:
Human(1901) Summary: The protein encoded by this gene is structurally similar to G protein-coupled receptors and is highly expressed in endothelial cells. It binds the ligand sphingosine-1-phosphate with high affinity and high specificity, and suggested to be involved in the processes that regulate the differentiation of endothelial cells. Activation of this receptor induces cell-cell adhesion. [provided by RefSeq, Jul 2008]
Mouse(13609) sphingosine-1-phosphate receptor 1
Rat(29733) sphingosine-1-phosphate receptor 1
Zebrafish(64617) sphingosine-1-phosphate receptor 1
Horse(100050049) sphingosine-1-phosphate receptor 1
domestic cat(101091218) sphingosine-1-phosphate receptor 1
dog(490138) sphingosine-1-phosphate receptor 1
chicken(424462) sphingosine-1-phosphate receptor 1
cow(281135) sphingosine-1-phosphate receptor 1
sheep(101115839) sphingosine-1-phosphate receptor 1
naked mole-rat(101697978) sphingosine-1-phosphate receptor 1
Domestic Rabbit(100008820) sphingosine-1-phosphate receptor 1
domestic guinea pig(100723228) sphingosine-1-phosphate receptor 1
70 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306655 ANTI-DANRES1PR1(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
western blot pricing
SAB1411891 ANTI-EDG1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human,
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1305337 ANTI-EDG1(N-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
western blot pricing
SAB4500688 Anti-EDG1, N-Terminal antibody produced in rabbit affinity isolated antibody human
immunofluorescence, western blot pricing
SAB4504293 Anti-phospho-S1P Receptor EDG1 (pThr236) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry pricing
SAB4500687 Anti-S1P Receptor EDG1 antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunofluorescence, western blot pricing
PRS4809 Anti-S1P1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
E7403 Anti-S1P1, C-Terminal antibody produced in rabbit ~1 mg/mL, fractionated antiserum, buffered aqueous solution human
western blot pricing
HPA075568 Anti-S1PR1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
WH0001901M1 Monoclonal Anti-EDG1 antibody produced in mouse clone 2E12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403755 Monoclonal Anti-EDG1, (N-terminal) antibody produced in mouse clone 1F11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
S3944 SEW2871 ≥98% (HPLC), solid human pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
D3439 D-erythro-Dihydrosphingosine 1-phosphate ≥98% (TLC), waxy solid human pricing
S9666 Sphingosine 1-phosphate ≥95%, powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001400 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001400 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001400 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007901 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007901 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007901 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001400 Rosetta Predictions human pricing
NM_017301 Rosetta Predictions rat pricing
NM_007901 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001400 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245812 predicted 1829
2 SASI_Hs01_00245813 predicted 1614
3 SASI_Hs01_00245814 predicted 563
4 SASI_Hs01_00245815 predicted 1643
5 SASI_Hs01_00245816 predicted 929
6 SASI_Hs01_00245817 predicted 1535
7 SASI_Hs01_00245818 predicted 1557
8 SASI_Hs01_00245819 predicted 1387
9 SASI_Hs01_00245820 predicted 639
10 SASI_Hs01_00245821 predicted 577
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017301 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101785 predicted 273
2 SASI_Rn01_00101786 predicted 822
3 SASI_Rn01_00101787 predicted 411
4 SASI_Rn02_00261742 predicted 361
5 SASI_Rn01_00101790 predicted 645
6 SASI_Rn01_00101791 predicted 1251
7 SASI_Rn01_00101792 predicted 1333
8 SASI_Rn02_00261743 predicted 353
9 SASI_Rn01_00101794 predicted 1151
10 SASI_Rn02_00261744 predicted 1322
11 SASI_Rn01_00101788 predicted 1108
12 SASI_Rn01_00101789 predicted 1278
13 SASI_Rn01_00101793 predicted 1197
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007901 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312691 predicted 1638
2 SASI_Mm02_00312692 predicted 1107
3 SASI_Mm02_00312693 predicted 693
4 SASI_Mm02_00312694 predicted 1384
5 SASI_Mm02_00312695 predicted 928
6 SASI_Mm02_00312696 predicted 1544
7 SASI_Mm02_00312697 predicted 558
8 SASI_Mm02_00312698 predicted 639
9 SASI_Mm02_00312699 predicted 518
10 SASI_Mm02_00312700 predicted 873
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001400
S1PR1 MISSION shRNA Bacterial Glycerol Stock
sphingosine-1-phosphate receptor 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001400.2-1725s1c1
Sequence:CCGGCCCATGTGAAAGCGTCTCTTTCTCGAGAAAGAGACGCTTTCACATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001400.2-361s1c1
Sequence:CCGGGACAAGGAGAACAGCATTAAACTCGAGTTTAATGCTGTTCTCCTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001400.2-1295s1c1
Sequence:CCGGGCCGCAGCAAATCGGACAATTCTCGAGAATTGTCCGATTTGCTGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001400.2-1002s1c1
Sequence:CCGGGCTGCTCAAGACCGTAATTATCTCGAGATAATTACGGTCTTGAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001400.2-837s1c1
Sequence:CCGGCCACAAGCACTATATCCTCTTCTCGAGAAGAGGATATAGTGCTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001400.4-1271s21c1
Sequence:CCGGGCGCTGCTCAAGACCGTAATTCTCGAGAATTACGGTCTTGAGCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001400.4-926s21c1
Sequence:CCGGATCGCCATTGAGCGCTATATCCTCGAGGATATAGCGCTCAATGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001400.4-1613s21c1
Sequence:CCGGGACAACCCAGAGACCATTATGCTCGAGCATAATGGTCTCTGGGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001400
S1PR1 MISSION shRNA shRNA Plasmid DNA
sphingosine-1-phosphate receptor 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001400.2-1725s1c1
Sequence:CCGGCCCATGTGAAAGCGTCTCTTTCTCGAGAAAGAGACGCTTTCACATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001400.2-361s1c1
Sequence:CCGGGACAAGGAGAACAGCATTAAACTCGAGTTTAATGCTGTTCTCCTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001400.2-1295s1c1
Sequence:CCGGGCCGCAGCAAATCGGACAATTCTCGAGAATTGTCCGATTTGCTGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001400.2-1002s1c1
Sequence:CCGGGCTGCTCAAGACCGTAATTATCTCGAGATAATTACGGTCTTGAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001400.2-837s1c1
Sequence:CCGGCCACAAGCACTATATCCTCTTCTCGAGAAGAGGATATAGTGCTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001400.4-1271s21c1
Sequence:CCGGGCGCTGCTCAAGACCGTAATTCTCGAGAATTACGGTCTTGAGCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001400.4-926s21c1
Sequence:CCGGATCGCCATTGAGCGCTATATCCTCGAGGATATAGCGCTCAATGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001400.4-1613s21c1
Sequence:CCGGGACAACCCAGAGACCATTATGCTCGAGCATAATGGTCTCTGGGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001400
S1PR1 MISSION shRNA Lentiviral Transduction Particles
sphingosine-1-phosphate receptor 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001400.2-1725s1c1
Sequence:CCGGCCCATGTGAAAGCGTCTCTTTCTCGAGAAAGAGACGCTTTCACATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001400.2-361s1c1
Sequence:CCGGGACAAGGAGAACAGCATTAAACTCGAGTTTAATGCTGTTCTCCTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001400.2-1295s1c1
Sequence:CCGGGCCGCAGCAAATCGGACAATTCTCGAGAATTGTCCGATTTGCTGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001400.2-1002s1c1
Sequence:CCGGGCTGCTCAAGACCGTAATTATCTCGAGATAATTACGGTCTTGAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001400.2-837s1c1
Sequence:CCGGCCACAAGCACTATATCCTCTTCTCGAGAAGAGGATATAGTGCTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001400.4-1271s21c1
Sequence:CCGGGCGCTGCTCAAGACCGTAATTCTCGAGAATTACGGTCTTGAGCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001400.4-926s21c1
Sequence:CCGGATCGCCATTGAGCGCTATATCCTCGAGGATATAGCGCTCAATGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001400.4-1613s21c1
Sequence:CCGGGACAACCCAGAGACCATTATGCTCGAGCATAATGGTCTCTGGGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007901
VALIDATED
S1PR1 MISSION shRNA Bacterial Glycerol Stock
sphingosine-1-phosphate receptor 1
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007901.3-2248s1c1
Sequence:CCGGCCATGTAAACTGGGTCAAGTTCTCGAGAACTTGACCCAGTTTACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007901.3-1481s1c1
Sequence:CCGGCGGATCGTATCTTGTTGCAAACTCGAGTTTGCAACAAGATACGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007901.3-1552s1c1
Sequence:CCGGCATGGAATTTAGCCGCAGCAACTCGAGTTGCTGCGGCTAAATTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007901.3-1366s1c1
Sequence:CCGGGACCTGTGACATCCTGTACAACTCGAGTTGTACAGGATGTCACAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007901.3-1632s1c1
Sequence:CCGGCGTCTGGAAACGTCAATTCTTCTCGAGAAGAATTGACGTTTCCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007901.3-557s1c1
Sequence:CCGGGTCTCTGACTATGGGAACTATCTCGAGATAGTTCCCATAGTCAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007901.3-1219s1c1
Sequence:CCGGCTTCCGCAAGAACATCTCCAACTCGAGTTGGAGATGTTCTTGCGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007901.4-1631s21c1
Sequence:CCGGCGTCTGGAAACGTCAATTCTTCTCGAGAAGAATTGACGTTTCCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327996    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007901.4-2247s21c1
Sequence:CCGGCCATGTAAACTGGGTCAAGTTCTCGAGAACTTGACCCAGTTTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007901.4-1609s21c1
Sequence:CCGGGACAACCCAGAGACCATTATGCTCGAGCATAATGGTCTCTGGGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007901.4-684s1c1
Sequence:CCGGCATCATCCTAGAGAATATATTCTCGAGAATATATTCTCTAGGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007901.4-1099s1c1
Sequence:CCGGCTCTACCACAAGCACTATATTCTCGAGAATATAGTGCTTGTGGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007901.4-769s21c1
Sequence:CCGGCTAGCCCTCTCGGACCTATTACTCGAGTAATAGGTCCGAGAGGGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007901.4-576s21c1
Sequence:CCGGTGATATCATAGTCCGGCATTACTCGAGTAATGCCGGACTATGATATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007901
VALIDATED
S1PR1 MISSION shRNA shRNA Plasmid DNA
sphingosine-1-phosphate receptor 1
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007901.3-2248s1c1
Sequence:CCGGCCATGTAAACTGGGTCAAGTTCTCGAGAACTTGACCCAGTTTACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007901.3-1481s1c1
Sequence:CCGGCGGATCGTATCTTGTTGCAAACTCGAGTTTGCAACAAGATACGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007901.3-1552s1c1
Sequence:CCGGCATGGAATTTAGCCGCAGCAACTCGAGTTGCTGCGGCTAAATTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007901.3-1366s1c1
Sequence:CCGGGACCTGTGACATCCTGTACAACTCGAGTTGTACAGGATGTCACAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007901.3-1632s1c1
Sequence:CCGGCGTCTGGAAACGTCAATTCTTCTCGAGAAGAATTGACGTTTCCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007901.3-557s1c1
Sequence:CCGGGTCTCTGACTATGGGAACTATCTCGAGATAGTTCCCATAGTCAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007901.3-1219s1c1
Sequence:CCGGCTTCCGCAAGAACATCTCCAACTCGAGTTGGAGATGTTCTTGCGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007901.4-1631s21c1
Sequence:CCGGCGTCTGGAAACGTCAATTCTTCTCGAGAAGAATTGACGTTTCCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327996    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007901.4-2247s21c1
Sequence:CCGGCCATGTAAACTGGGTCAAGTTCTCGAGAACTTGACCCAGTTTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007901.4-1609s21c1
Sequence:CCGGGACAACCCAGAGACCATTATGCTCGAGCATAATGGTCTCTGGGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007901.4-684s1c1
Sequence:CCGGCATCATCCTAGAGAATATATTCTCGAGAATATATTCTCTAGGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007901.4-1099s1c1
Sequence:CCGGCTCTACCACAAGCACTATATTCTCGAGAATATAGTGCTTGTGGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007901.4-769s21c1
Sequence:CCGGCTAGCCCTCTCGGACCTATTACTCGAGTAATAGGTCCGAGAGGGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007901.4-576s21c1
Sequence:CCGGTGATATCATAGTCCGGCATTACTCGAGTAATGCCGGACTATGATATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007901
VALIDATED
S1PR1 MISSION shRNA Lentiviral Transduction Particles
sphingosine-1-phosphate receptor 1
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007901.3-2248s1c1
Sequence:CCGGCCATGTAAACTGGGTCAAGTTCTCGAGAACTTGACCCAGTTTACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007901.3-1481s1c1
Sequence:CCGGCGGATCGTATCTTGTTGCAAACTCGAGTTTGCAACAAGATACGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007901.3-1552s1c1
Sequence:CCGGCATGGAATTTAGCCGCAGCAACTCGAGTTGCTGCGGCTAAATTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007901.3-1366s1c1
Sequence:CCGGGACCTGTGACATCCTGTACAACTCGAGTTGTACAGGATGTCACAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007901.3-1632s1c1
Sequence:CCGGCGTCTGGAAACGTCAATTCTTCTCGAGAAGAATTGACGTTTCCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007901.3-557s1c1
Sequence:CCGGGTCTCTGACTATGGGAACTATCTCGAGATAGTTCCCATAGTCAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007901.3-1219s1c1
Sequence:CCGGCTTCCGCAAGAACATCTCCAACTCGAGTTGGAGATGTTCTTGCGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007901.4-1631s21c1
Sequence:CCGGCGTCTGGAAACGTCAATTCTTCTCGAGAAGAATTGACGTTTCCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327996    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007901.4-2247s21c1
Sequence:CCGGCCATGTAAACTGGGTCAAGTTCTCGAGAACTTGACCCAGTTTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007901.4-1609s21c1
Sequence:CCGGGACAACCCAGAGACCATTATGCTCGAGCATAATGGTCTCTGGGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007901.4-684s1c1
Sequence:CCGGCATCATCCTAGAGAATATATTCTCGAGAATATATTCTCTAGGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007901.4-1099s1c1
Sequence:CCGGCTCTACCACAAGCACTATATTCTCGAGAATATAGTGCTTGTGGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007901.4-769s21c1
Sequence:CCGGCTAGCCCTCTCGGACCTATTACTCGAGTAATAGGTCCGAGAGGGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007901.4-576s21c1
Sequence:CCGGTGATATCATAGTCCGGCATTACTCGAGTAATGCCGGACTATGATATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks