EMAIL THIS PAGE TO A FRIEND

SAG

S-antigen; retina and pineal gland (arrestin)

Synonyms: RP47 S-AG
UniProtKB ID: P10523, Q53SV3, Q99858
Gene ID:
Human(6295) Summary: Members of arrestin/beta-arrestin protein family are thought to participate in agonist-mediated desensitization of G-protein-coupled receptors and cause specific dampening of cellular responses to stimuli such as hormones, neurotransmitters, or sensory signals. S-arrestin, also known as S-antigen, is a major soluble photoreceptor protein that is involved in desensitization of the photoactivated transduction cascade. It is expressed in the retina and the pineal gland and inhibits coupling of rhodopsin to transducin in vitro. Additionally, S-arrestin is highly antigenic, and is capable of inducing experimental autoimmune uveoretinitis. Mutations in this gene have been associated with Oguchi disease, a rare autosomal recessive form of night blindness. [provided by RefSeq, Jul 2008]
Mouse(20215) S-antigen, retina and pineal gland (arrestin)
Rat(25539) S-antigen; retina and pineal gland (arrestin)
Horse(100064951) S-antigen; retina and pineal gland (arrestin)
domestic cat(101100991) S-antigen; retina and pineal gland (arrestin)
dog(403906) S-antigen; retina and pineal gland (arrestin)
chicken(768877) S-antigen; retina and pineal gland (arrestin)
domestic guinea pig(100307116) retinal S-antigen
naked mole-rat(101713096) S-antigen; retina and pineal gland (arrestin)
cow(280922) S-antigen; retina and pineal gland (arrestin)
sheep(101105037) S-antigen; retina and pineal gland (arrestin)
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000541 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000541 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000541 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009118 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009118 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009118 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU039411 MISSION® esiRNA esiRNA human SAG (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000541 Rosetta Predictions human pricing
NM_013023 Rosetta Predictions rat pricing
NM_009118 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000541 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047630 predicted 747
2 SASI_Hs01_00047631 predicted 1368
3 SASI_Hs01_00047632 predicted 1214
4 SASI_Hs01_00047633 predicted 1332
5 SASI_Hs01_00047634 predicted 275
6 SASI_Hs01_00047635 predicted 859
7 SASI_Hs01_00047636 predicted 937
8 SASI_Hs01_00047637 predicted 1335
9 SASI_Hs01_00047638 predicted 733
10 SASI_Hs01_00047639 predicted 1044
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013023 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110394 predicted 806
2 SASI_Rn01_00110395 predicted 879
3 SASI_Rn01_00110397 predicted 472
4 SASI_Rn01_00110398 predicted 251
5 SASI_Rn02_00260700 predicted 1025
6 SASI_Rn02_00260701 predicted 939
7 SASI_Rn01_00110399 predicted 539
8 SASI_Rn01_00110400 predicted 628
9 SASI_Rn01_00110401 predicted 1180
10 SASI_Rn01_00110402 predicted 237
11 SASI_Rn01_00110396 predicted 589
12 SASI_Rn01_00110403 predicted 500
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009118 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049973 predicted 1105
2 SASI_Mm02_00315388 predicted 1062
3 SASI_Mm01_00049974 predicted 1181
4 SASI_Mm01_00049975 predicted 383
5 SASI_Mm01_00049976 predicted 1178
6 SASI_Mm01_00049977 predicted 1267
7 SASI_Mm01_00049978 predicted 1047
8 SASI_Mm01_00049980 predicted 734
9 SASI_Mm01_00049981 predicted 1115
10 SASI_Mm01_00049982 predicted 1065
11 SASI_Mm01_00049979 predicted 486
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000541
SAG MISSION shRNA Bacterial Glycerol Stock
S-antigen; retina and pineal gland (arrestin)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000541.4-1066s21c1
Sequence:CCGGGACCGTGACTGTCACCAATAACTCGAGTTATTGGTGACAGTCACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000541.4-1527s21c1
Sequence:CCGGAGGAGTTTGCTCGCCATAATCCTCGAGGATTATGGCGAGCAAACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000541.4-1024s21c1
Sequence:CCGGTCTCAACAAAGAGATCTATTTCTCGAGAAATAGATCTCTTTGTTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000541.4-415s21c1
Sequence:CCGGGTCCGAACCGAACCATGTTATCTCGAGATAACATGGTTCGGTTCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000541.x-345s1c1
Sequence:CCGGGTCGTGTTGGTTGATCCTGATCTCGAGATCAGGATCAACCAACACGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002897    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000541.x-1493s1c1
Sequence:CCGGCCTTTGGAGTTATGCTGCGTACTCGAGTACGCAGCATAACTCCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000541.x-1073s1c1
Sequence:CCGGCAATCGAGAAAGGAGAGGCATCTCGAGATGCCTCTCCTTTCTCGATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000541.x-1142s1c1
Sequence:CCGGCACCATCATTAAGGAGGGCATCTCGAGATGCCCTCCTTAATGATGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000541.x-913s1c1
Sequence:CCGGCCGTGAAGAAGATTAAAGCATCTCGAGATGCTTTAATCTTCTTCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000541
SAG MISSION shRNA shRNA Plasmid DNA
S-antigen; retina and pineal gland (arrestin)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000541.4-1066s21c1
Sequence:CCGGGACCGTGACTGTCACCAATAACTCGAGTTATTGGTGACAGTCACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000541.4-1527s21c1
Sequence:CCGGAGGAGTTTGCTCGCCATAATCCTCGAGGATTATGGCGAGCAAACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000541.4-1024s21c1
Sequence:CCGGTCTCAACAAAGAGATCTATTTCTCGAGAAATAGATCTCTTTGTTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000541.4-415s21c1
Sequence:CCGGGTCCGAACCGAACCATGTTATCTCGAGATAACATGGTTCGGTTCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000541.x-345s1c1
Sequence:CCGGGTCGTGTTGGTTGATCCTGATCTCGAGATCAGGATCAACCAACACGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002897    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000541.x-1493s1c1
Sequence:CCGGCCTTTGGAGTTATGCTGCGTACTCGAGTACGCAGCATAACTCCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000541.x-1073s1c1
Sequence:CCGGCAATCGAGAAAGGAGAGGCATCTCGAGATGCCTCTCCTTTCTCGATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000541.x-1142s1c1
Sequence:CCGGCACCATCATTAAGGAGGGCATCTCGAGATGCCCTCCTTAATGATGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000541.x-913s1c1
Sequence:CCGGCCGTGAAGAAGATTAAAGCATCTCGAGATGCTTTAATCTTCTTCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000541
SAG MISSION shRNA Lentiviral Transduction Particles
S-antigen; retina and pineal gland (arrestin)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000541.4-1066s21c1
Sequence:CCGGGACCGTGACTGTCACCAATAACTCGAGTTATTGGTGACAGTCACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000541.4-1527s21c1
Sequence:CCGGAGGAGTTTGCTCGCCATAATCCTCGAGGATTATGGCGAGCAAACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000541.4-1024s21c1
Sequence:CCGGTCTCAACAAAGAGATCTATTTCTCGAGAAATAGATCTCTTTGTTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000541.4-415s21c1
Sequence:CCGGGTCCGAACCGAACCATGTTATCTCGAGATAACATGGTTCGGTTCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000541.x-345s1c1
Sequence:CCGGGTCGTGTTGGTTGATCCTGATCTCGAGATCAGGATCAACCAACACGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002897    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000541.x-1493s1c1
Sequence:CCGGCCTTTGGAGTTATGCTGCGTACTCGAGTACGCAGCATAACTCCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000541.x-1073s1c1
Sequence:CCGGCAATCGAGAAAGGAGAGGCATCTCGAGATGCCTCTCCTTTCTCGATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000541.x-1142s1c1
Sequence:CCGGCACCATCATTAAGGAGGGCATCTCGAGATGCCCTCCTTAATGATGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000541.x-913s1c1
Sequence:CCGGCCGTGAAGAAGATTAAAGCATCTCGAGATGCTTTAATCTTCTTCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009118
SAG MISSION shRNA Bacterial Glycerol Stock
S-antigen; retina and pineal gland (arrestin)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009118.2-1344s1c1
Sequence:CCGGCCTGGTGTCATACCATATCAACTCGAGTTGATATGGTATGACACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009118.2-998s1c1
Sequence:CCGGCCCTCAGCAAAGAGATATATTCTCGAGAATATATCTCTTTGCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009118.2-696s1c1
Sequence:CCGGGCTCAAGAAACTGGGAGACAACTCGAGTTGTCTCCCAGTTTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009118.2-481s1c1
Sequence:CCGGAGCCAAGTAGAGCCTGTAGATCTCGAGATCTACAGGCTCTACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009118.2-1109s1c1
Sequence:CCGGCCAATGTGGTTCTCTACTCAACTCGAGTTGAGTAGAGAACCACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009118
SAG MISSION shRNA shRNA Plasmid DNA
S-antigen; retina and pineal gland (arrestin)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009118.2-1344s1c1
Sequence:CCGGCCTGGTGTCATACCATATCAACTCGAGTTGATATGGTATGACACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009118.2-998s1c1
Sequence:CCGGCCCTCAGCAAAGAGATATATTCTCGAGAATATATCTCTTTGCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009118.2-696s1c1
Sequence:CCGGGCTCAAGAAACTGGGAGACAACTCGAGTTGTCTCCCAGTTTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009118.2-481s1c1
Sequence:CCGGAGCCAAGTAGAGCCTGTAGATCTCGAGATCTACAGGCTCTACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009118.2-1109s1c1
Sequence:CCGGCCAATGTGGTTCTCTACTCAACTCGAGTTGAGTAGAGAACCACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009118
SAG MISSION shRNA Lentiviral Transduction Particles
S-antigen; retina and pineal gland (arrestin)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009118.2-1344s1c1
Sequence:CCGGCCTGGTGTCATACCATATCAACTCGAGTTGATATGGTATGACACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009118.2-998s1c1
Sequence:CCGGCCCTCAGCAAAGAGATATATTCTCGAGAATATATCTCTTTGCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009118.2-696s1c1
Sequence:CCGGGCTCAAGAAACTGGGAGACAACTCGAGTTGTCTCCCAGTTTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009118.2-481s1c1
Sequence:CCGGAGCCAAGTAGAGCCTGTAGATCTCGAGATCTACAGGCTCTACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009118.2-1109s1c1
Sequence:CCGGCCAATGTGGTTCTCTACTCAACTCGAGTTGAGTAGAGAACCACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks